Glyma17g16610 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g16610

Feature Type:	gene_model
Chromosome:	Gm17
Start:	13342339
stop:	13347047
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g16610

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G32550	AT	Annotation by Michelle Graham. TAIR10: 2Fe-2S ferredoxin-like superfamily protein \| chr1:11771969-11774117 REVERSE LENGTH=181	SoyBase	E_val: 9.00E-86	ISS
GO:0006098	GO-bp	Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt	SoyBase	N/A	ISS
GO:0009688	GO-bp	Annotation by Michelle Graham. GO Biological Process: abscisic acid biosynthetic process	SoyBase	N/A	ISS
GO:0010103	GO-bp	Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis	SoyBase	N/A	ISS
GO:0019288	GO-bp	Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway	SoyBase	N/A	ISS
GO:0022900	GO-bp	Annotation by Michelle Graham. GO Biological Process: electron transport chain	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009055	GO-mf	Annotation by Michelle Graham. GO Molecular Function: electron carrier activity	SoyBase	N/A	ISS
GO:0051536	GO-mf	Annotation by Michelle Graham. GO Molecular Function: iron-sulfur cluster binding	SoyBase	N/A	ISS
GO:0051537	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 2 iron, 2 sulfur cluster binding	SoyBase	N/A	ISS
PF00111	PFAM	2Fe-2S iron-sulfur cluster binding domain	JGI		ISS
UniRef100_G7JGG5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Ferredoxin-6 n=1 Tax=Medicago truncatula RepID=G7JGG5_MEDTR	SoyBase	E_val: 2.00E-96	ISS
UniRef100_I1MVE7	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MVE7_SOYBN	SoyBase	E_val: 3.00E-130	ISS

Expression Patterns of Glyma17g16610

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g16610

Paralog	Evidence	Comments
Glyma05g23690	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g16610 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.17g154900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma17g16610

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g16610

Limit To All Plant Sequences

>Glyma17g16610.1   sequence type=CDS   gene model=Glyma17g16610   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCACTTCCCCTTCTTCGAATCCCCGGGATTCCACTTGCCAAGCAACACCAATCATTCCCTTCCAATACCCGCCGCAAAGCCACGACGGCGCAGGCGGAGCTCGAGACAGCGGTGGCGCGGACGGGCGGAACCGGTTACCAGTCTCCGTCCGTCGATGTTCCCACGCATAAGGTCATAGTCCACGACAGACAACGAGGAATCGTTCACGAATTCGTCGTGCCTGAGGACCAGTATATATTACATACTGCTGAGGCCCAGAATATTACCCTTCCATTCGCCTGCAGGCATGGTTGTTGTACTAGCTGTGCTGTACGTATAAAGAATGGAAAGATTAGGCAACCAGAGGCACTAGGGATATCGGCCGAATTGAGAGACAAGGGTTATGCACTTCTTTGTGTGGGCTTCCCAACCTCTGATGTTGAAGTGGAAACTCAAGATGAAGATGAGGTATATTGGCTTCAATTTGGACGTTATTTTGCTCGAGGACCAGTGGAAAGAGATGACTATGCCTTGGAGTTGGCCATGGCTGACGAGTAA

Predicted protein sequences of Glyma17g16610

Limit To All Plant Sequences

>Glyma17g16610.1   sequence type=predicted peptide   gene model=Glyma17g16610   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALPLLRIPGIPLAKQHQSFPSNTRRKATTAQAELETAVARTGGTGYQSPSVDVPTHKVIVHDRQRGIVHEFVVPEDQYILHTAEAQNITLPFACRHGCCTSCAVRIKNGKIRQPEALGISAELRDKGYALLCVGFPTSDVEVETQDEDEVYWLQFGRYFARGPVERDDYALELAMADE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain