Glyma17g16580 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g16580

Feature Type:	gene_model
Chromosome:	Gm17
Start:	13313193
stop:	13317480
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g16580

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G35320	AT	Annotation by Michelle Graham. TAIR10: EYES ABSENT homolog \| chr2:14867074-14868387 REVERSE LENGTH=307	SoyBase	E_val: 6.00E-133	ISS
GO:0006470	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein dephosphorylation	SoyBase	N/A	ISS
GO:0007275	GO-bp	Annotation by Michelle Graham. GO Biological Process: multicellular organismal development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0030946	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein tyrosine phosphatase activity, metal-dependent	SoyBase	N/A	ISS
PTHR10190	Panther	EYES ABSENT HOMOLOG	JGI		ISS
PTHR10190:SF4	Panther	EYES ABSENT HOMOLOG 3	JGI		ISS
UniRef100_G7JGG7	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Eyes absent-like protein n=1 Tax=Medicago truncatula RepID=G7JGG7_MEDTR	SoyBase	E_val: 5.00E-180	ISS
UniRef100_I1MVE2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MVE2_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma17g16580

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g16580

Paralog	Evidence	Comments
Glyma05g23731	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g16580 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.17g154600	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma17g16580

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g16580

Limit To All Plant Sequences

>Glyma17g16580.1   sequence type=CDS   gene model=Glyma17g16580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTACCGCGTCTGGCATGCCTGAGCAGGAGACACAGGTGTTTTCTGGCAACAATGACCAATATCCTAGGTTGGATGTCTACGTGTGGGACATGGATGAGACTCTTGTATTGCTAAACTCCTTGCTGAAATCATCCTATGCTGAGGCTTTTAACGGTCTGAAGGATGTGCAGAAGGGGGTGGAAATCGGGAGGACGTGGGAAAATCTCATTCTACAAATATGTGATGATTATTTCTTCTATGAACAAATTGAAAATTACAATAAGCCATTTCTTGATGCTCTGGCCCAATATGATGATGGGAGGGACCTATCTGATTATGACTTCAACCAAGATGAATTAGGTTCCCCACATGAGGATGATGCCAACAATAGAAAACTTGCATATAGGCATCGAGTCATTGCCCAAAAATACTTACAGGGTTTACGTAATATTTTAGATCATGAGACAATAAAACTCTGGGATGAATTGTATGATAAAACTGATGAATACACTGACAGGTGGCTTTCATCAGCACGGACGTTTTTGAAGGAGTGTTCGGGTGAAGATAAAGATGCAGTTTCCTCTGTTGCTTTTGCTAACACTAGCTCAAACTCAACTAATTCAAATCATGTAAATGTTTTAGTGACATCTGGATCGATAGTTCCCTCCCTTGTGAAATGCATGCTCTTTCATCTGGACAGCTTAATAACGCATGGAAATGTTTATAGCTCATGGGAAGTGGGGAAAATTCAATGTTTCCGATGGATCAAGGAGCGTTTCAACCATCCCAATGTTCGATTTTGTGCAATTGGAGATGGATGGGAAGAGTGTGAGGCAGCAGAAATCATGAGATGGCCATTTGTTAAGATCGATCCACGGCCAGGAAAACTTCACAGGTTCCCTGGTCTCACATTGACAACAGTTAGCCACTACTTTTCTGTGGTGTATGGAAGGCCGGGCAACGAGAATGATGAAGAATGA

Predicted protein sequences of Glyma17g16580

Limit To All Plant Sequences

>Glyma17g16580.1   sequence type=predicted peptide   gene model=Glyma17g16580   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATASGMPEQETQVFSGNNDQYPRLDVYVWDMDETLVLLNSLLKSSYAEAFNGLKDVQKGVEIGRTWENLILQICDDYFFYEQIENYNKPFLDALAQYDDGRDLSDYDFNQDELGSPHEDDANNRKLAYRHRVIAQKYLQGLRNILDHETIKLWDELYDKTDEYTDRWLSSARTFLKECSGEDKDAVSSVAFANTSSNSTNSNHVNVLVTSGSIVPSLVKCMLFHLDSLITHGNVYSSWEVGKIQCFRWIKERFNHPNVRFCAIGDGWEECEAAEIMRWPFVKIDPRPGKLHRFPGLTLTTVSHYFSVVYGRPGNENDEE*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain