SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma17g14191): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma17g14191): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma17g14191

Feature Type:gene_model
Chromosome:Gm17
Start:10961514
stop:10969933
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G22950AT Annotation by Michelle Graham. TAIR10: AGAMOUS-like 19 | chr4:12023946-12027421 REVERSE LENGTH=219 SoyBaseE_val: 2.00E-72ISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0010048GO-bp Annotation by Michelle Graham. GO Biological Process: vernalization response SoyBaseN/AISS
GO:0043481GO-bp Annotation by Michelle Graham. GO Biological Process: anthocyanin accumulation in tissues in response to UV light SoyBaseN/AISS
GO:0048440GO-bp Annotation by Michelle Graham. GO Biological Process: carpel development SoyBaseN/AISS
GO:0048510GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of timing of transition from vegetative to reproductive phase SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0046983GO-mf Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity SoyBaseN/AISS
KOG0014 KOG MADS box transcription factor JGI ISS
PTHR11945Panther MADS BOX PROTEIN JGI ISS
PTHR11945:SF19Panther MADS BOX PROTEIN JGI ISS
PF00319PFAM SRF-type transcription factor (DNA-binding and dimerisation domain) JGI ISS
PF01486PFAM K-box region JGI ISS
UniRef100_B9GW46UniRef Annotation by Michelle Graham. Most informative UniRef hit: MIKC mads-box transcription factor n=1 Tax=Populus trichocarpa RepID=B9GW46_POPTR SoyBaseE_val: 2.00E-86ISS
UniRef100_C6TNA0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TNA0_SOYBN SoyBaseE_val: 6.00E-137ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g14191 not represented in the dataset

Glyma17g14191 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma05g03660 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g132700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma17g14191.1   sequence type=CDS   gene model=Glyma17g14191   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTGAGGGGGAAAACTCAGATGAAGCGCATCGAAAATGAGACGAGTAGGCAAGTAACGTTCTCCAAGAGAAGGAACGGGTTGCTCAAGAAGGCCTTTGAGCTTTCGGTGCTGTGTGAGGCTGAAGTCGCACTCATCATCTTCTCTACCAGAGGGAGGCTTTATGAGTTCTCCAGTTCAAGTGTAAATAAAACAGTTGAACGGTATCAAAGGAAGATCAAGGACCTGGGTGTCAGCAACAAAGGAATCCAAAAAAAAACCCGGCATCTGAAGGAAGGTGATATGAGCATGGCAAAGAAGATCGAGCATCTTGAAGATTCAAGAAGGAAGCTTTTGGGAGATGAATTGGATAAATGCAGTATTGACGAGTTACAACAGCTAGAGAACCAGCTCGAACGCAGCTTGGACAAAATTAGGGCAAGAAAGAATCAATTGTTCAGGGAGCGAATCGAGAACCTAAAACAAGAGGAAAAGTGCTTACTCGAAGTAAATAAACGCTTACGAGAGCAGTATCGGATTGACCGACAACGTTGTTTGACCGACAACGTTACAGAAAAAGAGGCAGAAGAGGTGGAGACGGAGTTATTCATAGGAAGACCTGAGAGAAGAATGCCGTTGAAGTTGAAATCTGCAACACATAGTGCTCATAAATACATAGCGTAA

>Glyma17g14191.1   sequence type=predicted peptide   gene model=Glyma17g14191   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVRGKTQMKRIENETSRQVTFSKRRNGLLKKAFELSVLCEAEVALIIFSTRGRLYEFSSSSVNKTVERYQRKIKDLGVSNKGIQKKTRHLKEGDMSMAKKIEHLEDSRRKLLGDELDKCSIDELQQLENQLERSLDKIRARKNQLFRERIENLKQEEKCLLEVNKRLREQYRIDRQRCLTDNVTEKEAEEVETELFIGRPERRMPLKLKSATHSAHKYIA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo