Report for Sequence Feature Glyma17g13860
Feature Type: gene_model
Chromosome: Gm17
Start: 10653784
stop: 10659647
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma17g13860
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G63460 AT
Annotation by Michelle Graham. TAIR10: SAP domain-containing protein | chr5:25413605-25415399 REVERSE LENGTH=162
SoyBase E_val: 7.00E-61 ISS
GO:0008150 GO-bp
Annotation by Michelle Graham. GO Biological Process: biological process
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0003676 GO-mf
Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding
SoyBase N/A ISS
GO:0003677 GO-mf
Annotation by Michelle Graham. GO Molecular Function: DNA binding
SoyBase N/A ISS
PF02037 PFAM
SAP domain
JGI ISS
PF10172 PFAM
Det1 complexing ubiquitin ligase
JGI ISS
UniRef100_D7MPN9 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: SAP domain-containing protein n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7MPN9_ARALL
SoyBase E_val: 7.00E-60 ISS
UniRef100_I1MUP4 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1MUP4_SOYBN
SoyBase E_val: 5.00E-124 ISS
Expression Patterns of Glyma17g13860
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma17g13860
Paralog Evidence Comments
Glyma05g03281 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma17g13860 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.17g129300 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma17g13860
Coding sequences of Glyma17g13860
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma17g13860.2 sequence type=CDS gene model=Glyma17g13860 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTGTCATGAGTCGAGTTGCAAAGTGCGCGTAAAGGGGACTCGTCAAAGGAAGAGTCCACAAGCATTACATTACTACAATTACAACTTACAAGGTCCACCACCCTTCCCCGTGTTGGTCCACATATATATAGAGCAGAAAGTTACGGTGTTGTTGTTGGAGTCGCTTCACATTTCAAGTGTGACACTTCGAAGAACAAAAAAAGAGGCCAAGTCCTCCTCCGTTCCAGTGGCAATGGATGCACCGAATCCTTCTTCTTCCGGCGCTTCTCCGTTCCTCGCCAATCTTCCCTCTCGCGGCCTCTTCTCTTCCACCGTCGTTTCTTCCAATCCGGGTGGAATGCGGGTCTATGTATGCAATCATGATACCTCACCACCAGAAGGTCAACATATTAAGACAAACCAACAAAACATACTGATTAGATCACTCACCCTCAAGAAACAAAAGGGTGATTCCAGCTCAAAGGATGGATCCGATGGTTCAAGAAAGAGGAATGCTGAAAAGGGTTTGGAAAGAGCATCAGCCAAGAAAACAAATAATCAAATAAATTCCAGACAAGAGGGATCGAACAGTCAAACAACCACTAGGGACTTCCACCACCTGACTGTGGAGAGGCTTCGTGCGCTTTTGAAATCTAAAGGCCTTTCAACCAAAGGAAAGAAGGAGGAGCTTATTACTCGTCTAAAAGATGCAACTGGTTAA
Predicted protein sequences of Glyma17g13860
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma17g13860.2 sequence type=predicted peptide gene model=Glyma17g13860 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MCHESSCKVRVKGTRQRKSPQALHYYNYNLQGPPPFPVLVHIYIEQKVTVLLLESLHISSVTLRRTKKEAKSSSVPVAMDAPNPSSSGASPFLANLPSRGLFSSTVVSSNPGGMRVYVCNHDTSPPEGQHIKTNQQNILIRSLTLKKQKGDSSSKDGSDGSRKRNAEKGLERASAKKTNNQINSRQEGSNSQTTTRDFHHLTVERLRALLKSKGLSTKGKKEELITRLKDATG*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
