Glyma17g13320 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g13320

Feature Type:	gene_model
Chromosome:	Gm17
Start:	10191661
stop:	10192293
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g13320

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G19790	AT	Annotation by Michelle Graham. TAIR10: related to AP2 11 \| chr5:6689271-6690032 REVERSE LENGTH=253	SoyBase	E_val: 1.00E-24	ISS
GO:0000302	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to reactive oxygen species	SoyBase	N/A	ISS
GO:0009723	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus	SoyBase	N/A	ISS
GO:0035865	GO-bp	Annotation by Michelle Graham. GO Biological Process: cellular response to potassium ion	SoyBase	N/A	ISS
GO:0048528	GO-bp	Annotation by Michelle Graham. GO Biological Process: post-embryonic root development	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0003677	GO-mf	Annotation by Michelle Graham. GO Molecular Function: DNA binding	SoyBase	N/A	ISS
GO:0003700	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity	SoyBase	N/A	ISS
GO:0043565	GO-mf	Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding	SoyBase	N/A	ISS
PF00847	PFAM	AP2 domain	JGI		ISS
UniRef100_G7JT22	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Ethylene-responsive transcription factor n=1 Tax=Medicago truncatula RepID=G7JT22_MEDTR	SoyBase	E_val: 2.00E-85	ISS
UniRef100_I1MUI6	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MUI6_SOYBN	SoyBase	E_val: 5.00E-156	ISS

Expression Patterns of Glyma17g13320

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g13320

Paralog	Evidence	Comments
Glyma05g07690	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g13320 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.17g124100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma17g13320

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g13320

Limit To All Plant Sequences

>Glyma17g13320.1   sequence type=CDS   gene model=Glyma17g13320   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAAACATAGACACCTCAAAATTTTCGCACCAATCTCAAAACCAAAACAAGAATAATATTCCCTTGATGTCTATTGAAATATTAGACAAGTCCTATGAGAAGAGAGTCGTGAATAAGGTTCCAAAAGTAGCAAACAAGAGTGAGAAAAAGTTTCTTGGGGTGAGACAAAGACCTTCAGGAAGATGGATTGCTGAGATCAAGGACTCCTCTCAGAAACTAAGACTTTGGTTAGGAACTTTTGACAAAGCAGAAGAAGCTGCCTTGGCTTATGACTGTGCTGCAAGGCTTCTTAGAGGGAGAAATGCCAAAACAAACTTTCCAAACAACCCTGGAATCATGAACACTACTCATGAAGAAGATTGCAGCATTTTGGGTAAGAATCCAAGGGCTTATCAACTTCTTAAGCATGCAGTCATGAAGAATAACCATGCACTTTATTCCACAGTCATGCCTTGGAAAAACCAGATCATGGTGAGAGACGAATTTGACACCCTTGTTGAGGAAACTATAGTTTGTTCCATTCCTGAACAAGGTTCTGGTTGTTGTGGAATTTCATTTGGAAGTTCTAAGGTTTATTCTTCTGTTGTTGTAGCTCCTTCTTTCAGTGCTTCTCATGATGAAACCTCCTAA

Predicted protein sequences of Glyma17g13320

Limit To All Plant Sequences

>Glyma17g13320.1   sequence type=predicted peptide   gene model=Glyma17g13320   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MENIDTSKFSHQSQNQNKNNIPLMSIEILDKSYEKRVVNKVPKVANKSEKKFLGVRQRPSGRWIAEIKDSSQKLRLWLGTFDKAEEAALAYDCAARLLRGRNAKTNFPNNPGIMNTTHEEDCSILGKNPRAYQLLKHAVMKNNHALYSTVMPWKNQIMVRDEFDTLVEETIVCSIPEQGSGCCGISFGSSKVYSSVVVAPSFSASHDETS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain