Report for Sequence Feature Glyma17g12200
Feature Type: gene_model
Chromosome: Gm17
Start: 9238380
stop: 9242651
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma17g12200
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT2G26580 AT
Annotation by Michelle Graham. TAIR10: plant-specific transcription factor YABBY family protein | chr2:11303923-11306739 REVERSE LENGTH=164
SoyBase E_val: 4.00E-89 ISS
GO:0006333 GO-bp
Annotation by Michelle Graham. GO Biological Process: chromatin assembly or disassembly
SoyBase N/A ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0006417 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of translation
SoyBase N/A ISS
GO:0009657 GO-bp
Annotation by Michelle Graham. GO Biological Process: plastid organization
SoyBase N/A ISS
GO:0009965 GO-bp
Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis
SoyBase N/A ISS
GO:0030154 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell differentiation
SoyBase N/A ISS
GO:0045893 GO-bp
Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0003700 GO-mf
Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity
SoyBase N/A ISS
PF04690 PFAM
YABBY protein
JGI ISS
UniRef100_C6SYG8 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SYG8_SOYBN
SoyBase E_val: 7.00E-137 ISS
UniRef100_G7JE42 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: YABBY protein n=1 Tax=Medicago truncatula RepID=G7JE42_MEDTR
SoyBase E_val: 3.00E-120 ISS
Expression Patterns of Glyma17g12200
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma17g12200
Paralog Evidence Comments
Glyma13g22620 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma17g12200 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.17g113400 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma17g12200
Coding sequences of Glyma17g12200
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma17g12200.1 sequence type=CDS gene model=Glyma17g12200 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTCGAGCTGCAGCATCGATGTTGCGCCTGAGCAACTCTGCTACATCCCCTGCAACTTTTGCAATATTGTTCTTGCGGTGAGTGTTCCATGCAGTAGCCTGTTTGACATTGTGACCGTTCGATGTGGGCACTGCACCAATCTATGGTCCGTGAACATGGCCGCCGCGTTTCAGTCACTGTCATGGCAAGATGTTCAGGGACCTGGGCAGTGCAATCCAGAGTACAGGATTGACACTGGCTCCACGTCGAAATGCAACAATAGGATTGCAATGCGTGCACCCACCACTCATGTAACTGAGGAAAGGGTTGTGAACAGGCCTCCCGAGAAGAGGCAGCGCGTACCTTCTGCTTATAACCAGTTTATAAAGGAAGAGATTCAGAGGATCAAAGCCAATAATCCTGATATCAGTCACAGAGAAGCTTTCAGTACAGCTGCAAAAAACTGGGCTCATTTTCCCCATATTCATTTCGGGCTGATGTTGGAGAGTAACAACCAAGCTAAGATGGATAATGTTTCTGAAAAGCATTTAATGCCAAGGGCTGCGCTATTGAATAAATGA
Predicted protein sequences of Glyma17g12200
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma17g12200.1 sequence type=predicted peptide gene model=Glyma17g12200 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSSCSIDVAPEQLCYIPCNFCNIVLAVSVPCSSLFDIVTVRCGHCTNLWSVNMAAAFQSLSWQDVQGPGQCNPEYRIDTGSTSKCNNRIAMRAPTTHVTEERVVNRPPEKRQRVPSAYNQFIKEEIQRIKANNPDISHREAFSTAAKNWAHFPHIHFGLMLESNNQAKMDNVSEKHLMPRAALLNK*