Glyma17g12050 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g12050

Feature Type:	gene_model
Chromosome:	Gm17
Start:	9080698
stop:	9083544
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g12050

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G32440	AT	Annotation by Michelle Graham. TAIR10: Ubiquitin system component Cue protein \| chr5:12077014-12078396 FORWARD LENGTH=264	SoyBase	E_val: 3.00E-45	ISS
GO:0000902	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell morphogenesis	SoyBase	N/A	ISS
GO:0016049	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell growth	SoyBase	N/A	ISS
GO:0048193	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi vesicle transport	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
UniRef100_B6TIC6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: CUE domain containing protein n=1 Tax=Zea mays RepID=B6TIC6_MAIZE	SoyBase	E_val: 1.00E-45	ISS
UniRef100_I1MU61	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MU61_SOYBN	SoyBase	E_val: 5.00E-106	ISS

Expression Patterns of Glyma17g12050

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g12050

Paralog	Evidence	Comments
Glyma13g22800	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g12050 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma17g12050

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g12050

Limit To All Plant Sequences

>Glyma17g12050.2   sequence type=CDS   gene model=Glyma17g12050   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
AGCAGAGGATCCGTTGTTCCTCTTCCTCTTCTCCCGTTCGCCTCTCTCCTCCACCATCTCCTCGAGAAAGTTCTCCAAGATTGCGGCAACGACATCGACTCCGCTATTAGAAGCTTAAACCAGTTACGCTTAGGAGGAGCACCACCACCTCCTTCTCTTGATTCTACTCTCATCGCATCTGACACTGCTCCTCCTCAATTCCAAGGTGAAGCAAAATGTGATGCAGAAGTTGCAGGTTCTGATGATCCAGTAGCTGGACTAAATTATCCTACAAACGGTGCCGAATGGGTAGAGCTTTTTGCGTTGGAGAAGTCCATTTGCGCAAGAGCAAGTGCTGAAACAGAGCGAAACATCCACCAGGAAAATAAGGTGCTGAAGGAACAAGTGGAGGCCCTTGTTCAAGAAAACGTGATTCTGAAGTGCGCTATCTGTATTCAGCACGAACGCCAGAAAGAATATGAAGACAGAAATCAAGAGTTGAAGCATTTGAAGCAATTAGTGTCGCAGTACCAGGAACAGGTAAGAGCTTTAGAGGTAAACAATTATGCATTGACAATGCACCTAAAGCAGGCTGAACTAGAGCTGGAAAAACAAACAAGCAACCCCACACATTACGTGAATGTTATACTTTAA

Predicted protein sequences of Glyma17g12050

Limit To All Plant Sequences

>Glyma17g12050.2   sequence type=predicted peptide   gene model=Glyma17g12050   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
SRGSVVPLPLLPFASLLHHLLEKVLQDCGNDIDSAIRSLNQLRLGGAPPPPSLDSTLIASDTAPPQFQGEAKCDAEVAGSDDPVAGLNYPTNGAEWVELFALEKSICARASAETERNIHQENKVLKEQVEALVQENVILKCAICIQHERQKEYEDRNQELKHLKQLVSQYQEQVRALEVNNYALTMHLKQAELELEKQTSNPTHYVNVIL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain