SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma17g11901): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma17g11901): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma17g11901

Feature Type:gene_model
Chromosome:Gm17
Start:8946369
stop:8949295
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma17g11901
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G55090AT Annotation by Michelle Graham. TAIR10: carbon-nitrogen hydrolase family protein | chr1:20554857-20558188 FORWARD LENGTH=725 SoyBaseE_val: 1.00E-56ISS
GO:0006807GO-bp Annotation by Michelle Graham. GO Biological Process: nitrogen compound metabolic process SoyBaseN/AISS
GO:0009435GO-bp Annotation by Michelle Graham. GO Biological Process: NAD biosynthetic process SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003952GO-mf Annotation by Michelle Graham. GO Molecular Function: NAD+ synthase (glutamine-hydrolyzing) activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016810GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds SoyBaseN/AISS
PTHR23090Panther NH(3)/GLUTAMINE-DEPENDENT NAD(+) SYNTHETASE JGI ISS
PTHR23090:SF1Panther GLUTAMINE-DEPENDENT NAD(+) SYNTHETASE JGI ISS
UniRef100_B9RYP7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Glutamine-dependent NAD(+) synthetase, putative n=1 Tax=Ricinus communis RepID=B9RYP7_RICCO SoyBaseE_val: 4.00E-55ISS
UniRef100_UPI000233956AUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233956A related cluster n=1 Tax=unknown RepID=UPI000233956A SoyBaseE_val: 4.00E-64ISS

Expression Patterns of Glyma17g11901
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g11901 not represented in the dataset
Glyma17g11901 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g11901 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma17g11901
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma17g11901
>Glyma17g11901.1   sequence type=CDS   gene model=Glyma17g11901   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGCAAAATGACCGTGAGCTAGAAATTGCAAATGGGGATGAGCATGTTAAAGCTAGTGCAATACGAATAGGAAACTATAAGGATGGCCAGTATCCTACAGACAACAGAGAATTTGCTAAACGAATATTCTATACTGTGTTTATGGGATCTGAAAACAGTTCAGAAATGACAAGGTCACGAGCCAAGGTGCTGGTTGATGAAATTGGTTCATGGAACCTTGATATAGATGGTGGATCTAATGTTGAGAATTTAAGCTTGCAGAACATTGAAGCTCGAATCAGAATGGTGCTAGCTTTCATGTTAGCATCACTCTTACCTTGGGTTCACAGCAAGCCTGGGGTTTATCTTGTCTTGGGGAGCTCCTATGTGGATGAAGGGTTACAAATGGCTGGGAGAAGAGAGGGTTCTTCATGCAGATTGCAGAAGAAGTCATCTATGGCAACATGCAGGGAGGTTGAGAAATAA
Predicted protein sequences of Glyma17g11901
>Glyma17g11901.1   sequence type=predicted peptide   gene model=Glyma17g11901   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEQNDRELEIANGDEHVKASAIRIGNYKDGQYPTDNREFAKRIFYTVFMGSENSSEMTRSRAKVLVDEIGSWNLDIDGGSNVENLSLQNIEARIRMVLAFMLASLLPWVHSKPGVYLVLGSSYVDEGLQMAGRREGSSCRLQKKSSMATCREVEK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo