SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma17g11720

Feature Type:gene_model
Chromosome:Gm17
Start:8797685
stop:8800909
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G20410AT Annotation by Michelle Graham. TAIR10: monogalactosyldiacylglycerol synthase 2 | chr5:6896765-6898581 FORWARD LENGTH=468 SoyBaseE_val: 0ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006631GO-bp Annotation by Michelle Graham. GO Biological Process: fatty acid metabolic process SoyBaseN/AISS
GO:0009247GO-bp Annotation by Michelle Graham. GO Biological Process: glycolipid biosynthetic process SoyBaseN/AISS
GO:0016036GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to phosphate starvation SoyBaseN/AISS
GO:0019374GO-bp Annotation by Michelle Graham. GO Biological Process: galactolipid metabolic process SoyBaseN/AISS
GO:0019375GO-bp Annotation by Michelle Graham. GO Biological Process: galactolipid biosynthetic process SoyBaseN/AISS
GO:0030259GO-bp Annotation by Michelle Graham. GO Biological Process: lipid glycosylation SoyBaseN/AISS
GO:0045892GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009707GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast outer membrane SoyBaseN/AISS
GO:0016757GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring glycosyl groups SoyBaseN/AISS
GO:0016758GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring hexosyl groups SoyBaseN/AISS
GO:0030246GO-mf Annotation by Michelle Graham. GO Molecular Function: carbohydrate binding SoyBaseN/AISS
GO:0035250GO-mf Annotation by Michelle Graham. GO Molecular Function: UDP-galactosyltransferase activity SoyBaseN/AISS
GO:0046509GO-mf Annotation by Michelle Graham. GO Molecular Function: 1,2-diacylglycerol 3-beta-galactosyltransferase activity SoyBaseN/AISS
PTHR21015Panther GLYCOSYLTRANSFERASE JGI ISS
PTHR21015:SF21Panther GLYCOSYLTRANSFERASE 1 FAMILY JGI ISS
PF04101PFAM Glycosyltransferase family 28 C-terminal domain JGI ISS
PF06925PFAM Monogalactosyldiacylglycerol (MGDG) synthase JGI ISS
UniRef100_G7JGJ5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Monogalactosyldiacylglycerol synthase n=1 Tax=Medicago truncatula RepID=G7JGJ5_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1MU28UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MU28_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma13g23150 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g108700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma17g11720.1   sequence type=CDS   gene model=Glyma17g11720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGTTTCCGTTTCGTCGCCGTCGCCGTCGCCGAGAAGGTCCATAGCGGAGAAGGTATTCGGAGGTTACTATAATGGGAACAACAGCCACAAAAAACGTGGCAGTGAGGCCCACGATGATGACAGCGATGGAGGCATGGAACTCATGGAGATTGGCGCGGAGAGGACAAAAAACGTGTTGATTCTCATGAGTGATACTGGTGGCGGTCACAGAGCTTCCGCTGAAGCCATTCGTGACGCCTTTCAAATTCAATTCGGTGACGAATACAGGATTTTTGTTAAAGATGTTTGGAAGGAATACACTGGGTGGCCATTGAATGACATGGAGGGGCAGTATAAGTTCATGGTTAAGCATGTACAGTTATGGAATGTTGCGTTTCACAGTACTTCTCCTAGATGGATTCACTCTGTGTATTTGGCTGCCATTGCTGCCTACTATGCCAGGGAGGTGGAGGCGGGGTTGATGGAGTACAAGCCAGATATCATCATCAGTGTCCATCCCTTGATGCAGCATATTCCATTGTGGGTTTTAAAGTGGCAAGGTTTGCAGAAGAAAGTGATTTTTGTCACAGTGATCACTGACCTTAGCACATGCCACCCTACTTGGTTTCATCCTTGGGTGAATAGATGTTACTGCCCTTCACAAGAAGTGGCCACGAAAGCCTCACAAGATGGCCTTGAGGAATCTCAAATCCGAGTTTTCGGCTTGCCCATTAGGCCTTCTTTTGCCAGGGCAGTTCTTGTCAAGGAACAATTGAGAGAAGAACTTGGGTTGGATCCCAACTTGCAAGCAGTTTTGCTGATGGGGGGTGGTGAAGGAATGGGTCCTGTGAAGAAAACTGCAAAGGCTCTTGGAGAAGCACTTTTCGATAAAGAAGCTGAGAAACCAATTGGGCAGTTAATCATCATATGTGGTCGTAACAAGAGCTTAGTATCTACCCTTGAATCTCTTGAATGGAAGATTCCAGTAAAGGTTAGAGGATTTGAGACCCAGATGGCCAAATGGATGGGAGCCTGTGACTGCATCATAACAAAAGCTGGACCAGGTACAATTGCGGAATCATTGATCAGAGGGCTTCCCATAATCCTCAATGACTACATCCCCGGACAAGAGAAGGGTAACGTGCCTTATGTGGTAAACAATGGAGCTGGTGTCTTCACTCGTAGTCCAAAGGAAACAGCAAGAATTGTGGCCGAATGGTTCACCACAAAATCAGATGAGAGGAAAACAATGTCAGAGAATGCACTTAAACTGGCACAACCAGAGGCCGTGTTTGACATCGTAAGGGACATTCATGAGCTTGCTGAGCAACGAGAGCCAGCAAAGTTTCCATACTTGTTGACCTCATCATTTACTAGCCTAATCTGA

>Glyma17g11720.1   sequence type=predicted peptide   gene model=Glyma17g11720   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEVSVSSPSPSPRRSIAEKVFGGYYNGNNSHKKRGSEAHDDDSDGGMELMEIGAERTKNVLILMSDTGGGHRASAEAIRDAFQIQFGDEYRIFVKDVWKEYTGWPLNDMEGQYKFMVKHVQLWNVAFHSTSPRWIHSVYLAAIAAYYAREVEAGLMEYKPDIIISVHPLMQHIPLWVLKWQGLQKKVIFVTVITDLSTCHPTWFHPWVNRCYCPSQEVATKASQDGLEESQIRVFGLPIRPSFARAVLVKEQLREELGLDPNLQAVLLMGGGEGMGPVKKTAKALGEALFDKEAEKPIGQLIIICGRNKSLVSTLESLEWKIPVKVRGFETQMAKWMGACDCIITKAGPGTIAESLIRGLPIILNDYIPGQEKGNVPYVVNNGAGVFTRSPKETARIVAEWFTTKSDERKTMSENALKLAQPEAVFDIVRDIHELAEQREPAKFPYLLTSSFTSLI*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo