Glyma17g11430 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g11430

Feature Type:	gene_model
Chromosome:	Gm17
Start:	8575792
stop:	8577759
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g11430

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT5G23740	AT	Annotation by Michelle Graham. TAIR10: ribosomal protein S11-beta \| chr5:8008251-8009330 REVERSE LENGTH=159	SoyBase	E_val: 2.00E-95	ISS
GO:0006412	GO-bp	Annotation by Michelle Graham. GO Biological Process: translation	SoyBase	N/A	ISS
GO:0005622	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: intracellular	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005840	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: ribosome	SoyBase	N/A	ISS
GO:0016020	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: membrane	SoyBase	N/A	ISS
GO:0022627	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosolic small ribosomal subunit	SoyBase	N/A	ISS
GO:0003735	GO-mf	Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome	SoyBase	N/A	ISS
KOG1728	KOG	40S ribosomal protein S11	JGI		ISS
PTHR10744	Panther	40S RIBOSOMAL PROTEIN S11 FAMILY MEMBER	JGI		ISS
PF00366	PFAM	Ribosomal protein S17	JGI		ISS
UniRef100_I1MU00	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MU00_SOYBN	SoyBase	E_val: 3.00E-112	ISS
UniRef100_P17093	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: 40S ribosomal protein S11 n=2 Tax=Glycine max RepID=RS11_SOYBN	SoyBase	E_val: 8.00E-112	ISS

Expression Patterns of Glyma17g11430

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g11430

Paralog	Evidence	Comments
Glyma13g23400	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g11430 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.17g105900	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma17g11430

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g11430

Limit To All Plant Sequences

>Glyma17g11430.1   sequence type=CDS   gene model=Glyma17g11430   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGAGCAAACCGAGAAGGCTTTTTTGAAACAACCAAAAGTGTTTCTCAGCTCGAAGAAAACTGGGAAGGGAAAGAGACCCGGAAAGGGTGGGAACCGCTTTTGGAAATCCATTGGGCTTGGATTTAAGACTCCCAGGGAAGCCATCGAAGGAACCTACATTGACAAGAAGTGCCCCTTCACTGGCAATGTTTCCATCCGTGGCCGTATCTTGGCTGGAACATGTCACAGTGCTAAGATGAACAGGACTATTATTGTTAGGAGGAATTATCTCCATTTTATCAAGAAGTACCAGAGGTACGAGAAAAGGCACTCCAACATTCCTGCTCATATATCACCTGCTTTCCGTGTGAAGGAAGGAGATCACGTTATTATTGGTCAATGCAGGCCACTTTCTAAGACTGTGAGGTTCAATGTGTTGAAAGTGATCCCAGCTGGATCTTCTAGCGGTGCAAAGAAGGCTTTTACTGGAATGTGA

Predicted protein sequences of Glyma17g11430

Limit To All Plant Sequences

>Glyma17g11430.1   sequence type=predicted peptide   gene model=Glyma17g11430   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAEQTEKAFLKQPKVFLSSKKTGKGKRPGKGGNRFWKSIGLGFKTPREAIEGTYIDKKCPFTGNVSIRGRILAGTCHSAKMNRTIIVRRNYLHFIKKYQRYEKRHSNIPAHISPAFRVKEGDHVIIGQCRPLSKTVRFNVLKVIPAGSSSGAKKAFTGM*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain