Glyma17g11370 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g11370

Feature Type:	gene_model
Chromosome:	Gm17
Start:	8540458
stop:	8542774
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g11370

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT2G15580	AT	Annotation by Michelle Graham. TAIR10: RING/U-box superfamily protein \| chr2:6797687-6798612 FORWARD LENGTH=130	SoyBase	E_val: 5.00E-15	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0008270	GO-mf	Annotation by Michelle Graham. GO Molecular Function: zinc ion binding	SoyBase	N/A	ISS
UniRef100_F4IIH8	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: RING/U-box domain-containing protein n=1 Tax=Arabidopsis thaliana RepID=F4IIH8_ARATH	SoyBase	E_val: 3.00E-12	ISS
UniRef100_I1MTZ5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1MTZ5_SOYBN	SoyBase	E_val: 6.00E-65	ISS

Expression Patterns of Glyma17g11370

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g11370 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.17g105300	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma17g11370

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g11370

Limit To All Plant Sequences

>Glyma17g11370.1   sequence type=CDS   gene model=Glyma17g11370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTGGGATGCTTCCGGGAGTTGAATGTGCTCGAAGGAGACGCTTGCATAACAGTGCTGGTGATGATTCCACCAGCAACCGCTCTTTCTGTTTGTATACTACCAGGAACCTCCAATCCTCTTCCTCTTTACTGGAAAGAAGCATGTTAAATCGGGCATACCCAGATGAAAATCTCGGAGGAGCGGCACGCGAAGCCAAACGGAGACTTGATCAGAAGTTCATGGCACATATCAAATCAGAAAGCCACAAAAGAAAAGGCCTTTTTCATGGTTTGTGGCGCCAACTCAGATCTTAG

Predicted protein sequences of Glyma17g11370

Limit To All Plant Sequences

>Glyma17g11370.1   sequence type=predicted peptide   gene model=Glyma17g11370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSGMLPGVECARRRRLHNSAGDDSTSNRSFCLYTTRNLQSSSSLLERSMLNRAYPDENLGGAAREAKRRLDQKFMAHIKSESHKRKGLFHGLWRQLRS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain