Glyma17g10120 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g10120

Feature Type:	gene_model
Chromosome:	Gm17
Start:	7572287
stop:	7575549
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g10120

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G74920	AT	Annotation by Michelle Graham. TAIR10: aldehyde dehydrogenase 10A8 \| chr1:28139175-28142573 REVERSE LENGTH=496	SoyBase	E_val: 9.00E-113	ISS
GO:0008152	GO-bp	Annotation by Michelle Graham. GO Biological Process: metabolic process	SoyBase	N/A	ISS
GO:0009414	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to water deprivation	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0055114	GO-bp	Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process	SoyBase	N/A	ISS
GO:0005618	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell wall	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0009507	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: chloroplast	SoyBase	N/A	ISS
GO:0009516	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: leucoplast	SoyBase	N/A	ISS
GO:0004028	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 3-chloroallyl aldehyde dehydrogenase activity	SoyBase	N/A	ISS
GO:0016491	GO-mf	Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity	SoyBase	N/A	ISS
PTHR11699	Panther	ALDEHYDE DEHYDROGENASE-RELATED	JGI		ISS
PTHR11699:SF45	Panther	gb def: succinic-semialdehyde dehydrogenase, putative [deinococcus radiodurans]	JGI		ISS
PF00171	PFAM	Aldehyde dehydrogenase family	JGI		ISS
UniRef100_B0M1A5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Betaine aldehyde dehydrogenase n=1 Tax=Glycine max RepID=B0M1A5_SOYBN	SoyBase	E_val: 5.00E-117	ISS
UniRef100_I1MTL5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MTL5_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma17g10120

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g10120

Paralog	Evidence	Comments
Glyma05g01770	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g10120 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments

References for Glyma17g10120

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g10120

Limit To All Plant Sequences

>Glyma17g10120.1   sequence type=CDS   gene model=Glyma17g10120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTACGTGGAAGGTTGCTCCTGCTTTGGCTGCGGGTTGTGCTGCAATATTGAAGCCCTCTGAGTTGCCGTCTGTGACGTGTTTGGAGCTTGCTCAAATTTGCCAAGAAGTCGGGCTTCCTCCTGTAGACAAGGTTTTAAATTGTAGCCACGGTCACAGTTTTGTCAATGCTTCACCTTACGAACAAATGCAGCTCATGTGGTCACAATTGCATGTGACATTGGGGCTGAAACTTTTCCAACAGATTGCCTTTACTGGAAGCTCTGCAACTGGGAGCAAGATTATGACAGCTGCAGCTCAGCTGATCAAGCCTGTTTCACTAGAGCTTGTGACTTCTCAACTGCTGAATAGACCATATTTGGCTGCTTCTGGACAAATGGTCAGATATGCAGCGCAACTTCCCGCCTTATTGTACATTATAGCAACAGAATTTTTGAATAGGATTGTGAAATGGGTCAAAAACATAAAAATTTATGATCCCTTGGAAGAAGGTTGCAGAATAGGTCCTATTTATGAAAAGATATTGAAGTTTATCTCGAATGCTAAGAGTGAGGGTGCAACCATTTTGACCGGTGGGTCTCACCCGGAGCATCTAAAGAAGGGATTCTTTGTTGAACCAACTGTCATAACTGACTATCTGGACCTGTTCTGTGTAAAAACATTTAGCACTGAAGAAGAAGCCATTGATCTAGCAAACGACACTGTATATGGCTTGGGTTCTGCTGTAATATCAAATGATATAGAAAGATGTGGGCGCGTTACTAAGGTGATACCAATCCTTGCTTCGATGCAGGTTTTTAAGGCTGGGATTGTGTGGATTAATTGCTCTAAACCGTGCTTCACTCAAGCACCATGGGGAGGCATTAAACGCAGTGGTTTTGGTCGTGAATTAGGAGAATGGAAAATTAATCATCTTTCTATTGAAAGACTG

Predicted protein sequences of Glyma17g10120

Limit To All Plant Sequences

>Glyma17g10120.1   sequence type=predicted peptide   gene model=Glyma17g10120   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATWKVAPALAAGCAAILKPSELPSVTCLELAQICQEVGLPPVDKVLNCSHGHSFVNASPYEQMQLMWSQLHVTLGLKLFQQIAFTGSSATGSKIMTAAAQLIKPVSLELVTSQLLNRPYLAASGQMVRYAAQLPALLYIIATEFLNRIVKWVKNIKIYDPLEEGCRIGPIYEKILKFISNAKSEGATILTGGSHPEHLKKGFFVEPTVITDYLDLFCVKTFSTEEEAIDLANDTVYGLGSAVISNDIERCGRVTKVIPILASMQVFKAGIVWINCSKPCFTQAPWGGIKRSGFGRELGEWKINHLSIERL

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain