SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma17g08370): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma17g08370): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma17g08370

Feature Type:gene_model
Chromosome:Gm17
Start:6201694
stop:6203210
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G13510AT Annotation by Michelle Graham. TAIR10: Ribosomal protein L10 family protein | chr5:4341294-4341956 FORWARD LENGTH=220 SoyBaseE_val: 2.00E-100ISS
GO:0006354GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent transcription, elongation SoyBaseN/AISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0009965GO-bp Annotation by Michelle Graham. GO Biological Process: leaf morphogenesis SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010103GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex morphogenesis SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0016556GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA modification SoyBaseN/AISS
GO:0030154GO-bp Annotation by Michelle Graham. GO Biological Process: cell differentiation SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042254GO-bp Annotation by Michelle Graham. GO Biological Process: ribosome biogenesis SoyBaseN/AISS
GO:0042793GO-bp Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0022626GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosolic ribosome SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
PTHR11560Panther 60S ACIDIC RIBOSOMAL PROTEIN P0-RELATED JGI ISS
PTHR11560:SF8Panther ACIDIC RIBOSOMAL PROTEIN P0 JGI ISS
PF00466PFAM Ribosomal protein L10 JGI ISS
UniRef100_B7FHY0UniRef Annotation by Michelle Graham. Most informative UniRef hit: 50S ribosomal protein L10 n=1 Tax=Medicago truncatula RepID=B7FHY0_MEDTR SoyBaseE_val: 2.00E-125ISS
UniRef100_I1MT40UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MT40_SOYBN SoyBaseE_val: 6.00E-168ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g08370 not represented in the dataset

Glyma17g08370 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma13g22310 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g075900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma17g08370.2   sequence type=CDS   gene model=Glyma17g08370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGACTACAATCACAAGATGATGGAAGCGATAAGATAAGCCAAACACTCCACACTTTCATCCATCTTTACTCTCTCTTTCCCCTAATTCCGACCATGGAAGCCACGGCCTCCGCAATGAGCTTCGCCCTTCCCTCAACAAAAGCCCAAGCCCAAGCCCAACTCCTGACCCGGCCCACCAATCCATTCACCATTCCCTCCCGCAGCCCAGCCCACCGCCCCCCGCCGCGCCTCCCCACCATCCGCGCCGCAATTCCCCGCACAAAGAAAGAGGCAACGGTGGAGACTGTGCGGGAGCAGCTCGAGAACTGTTACCTCCTCGCCGGCATCAACTACAAGGGCTTCACGGTGAAGCAGTTCCAGGAGCTTCGAAAGACGCTCCCAGAAACAACGAAACTGATCGTGGCGAAGAACACGCTCGTTTACAAGGCCGTGGAAGGCACGCCCTGGGAGACGCTGAAGCCCTGCATGAAGGGCATGAACGTGTGGCTCTTCGTCCACACCGAGGAGATCCCTTCCGCCATCAAGCCCTACAGGAACTTCCAGAAGGAGAAGAAGCTCGAGGACAACGACTTCACCGGCGCCGTTTTCGAAGGCAAGTTTTACGGCCCCGATGAGGTTAAGAACCTCGAATCCTTGCCCACGCGCGCTGAGATTTACGCCACCCTTTTGGGGGCTTTGAAGAGCCCTGCTTCCGCTCTTGTTGGCACTCTTCAGTCTCCTGCTAGGGAACTTGTTACGGTTCTCAAGGCGCATATTAAGAACCTTGAAGAACAACAAGGTGTTGCGCAATAG

>Glyma17g08370.2   sequence type=predicted peptide   gene model=Glyma17g08370   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRLQSQDDGSDKISQTLHTFIHLYSLFPLIPTMEATASAMSFALPSTKAQAQAQLLTRPTNPFTIPSRSPAHRPPPRLPTIRAAIPRTKKEATVETVREQLENCYLLAGINYKGFTVKQFQELRKTLPETTKLIVAKNTLVYKAVEGTPWETLKPCMKGMNVWLFVHTEEIPSAIKPYRNFQKEKKLEDNDFTGAVFEGKFYGPDEVKNLESLPTRAEIYATLLGALKSPASALVGTLQSPARELVTVLKAHIKNLEEQQGVAQ*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo