SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g08136

Feature Type:gene_model
Chromosome:Gm17
Start:6021134
stop:6021934
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma17g08136
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G30900AT Annotation by Michelle Graham. TAIR10: DNAse I-like superfamily protein | chr4:15040021-15042203 FORWARD LENGTH=316 SoyBaseE_val: 9.00E-107ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF03372PFAM Endonuclease/Exonuclease/phosphatase family JGI ISS
UniRef100_F4JR41UniRef Annotation by Michelle Graham. Most informative UniRef hit: Endonuclease/exonuclease/phosphatase domain-containing protein n=1 Tax=Arabidopsis thaliana RepID=F4JR41_ARATH SoyBaseE_val: 4.00E-104ISS
UniRef100_I1MT22UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MT22_SOYBN SoyBaseE_val: 1.00E-119ISS

Expression Patterns of Glyma17g08136
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g08136 not represented in the dataset
Glyma17g08136 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g08136
ParalogEvidenceComments
Glyma02g36540 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g08136 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments

References for Glyma17g08136
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma17g08136
>Glyma17g08136.1   sequence type=CDS   gene model=Glyma17g08136   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGATGAGTTTAGTCCTCGTGCCCGTAGGCGAAGTGCTTTACTTACATGGCAGCACATTGCATCCTTACCCCCTAGCCTACCGGTTGTGTACTGTGGAGGTTTCAATACACAAAAGGAATCAACTACTGGACGCTTTCTTCTTGGAAGATCAAGAGAGCATGGTGTCGTTGGGGATATGAGGGATGCATGGCCTAGTGCTCGTGTGAGGAAAAATGTTTCCCTAATCCGCACTTATCATGGATTCAAGGGTGACAAACAAGGAACCCTTGAATTCCTCAAGTTAATTTTTAGAGCTCTCTGCCTCTGCTGGGATCGCCAAACACAGGATCTTCACATTGATTGGATCCTTTTCAGAGGTAGATCGCTGATTCCTGTTTCTTGTGAAGTGGTAAATGATAATATTGATGGGTACTATCCATCATCACATTTTCCTATCTTTGCCGAGTTCATGCTTCCTCGCACTGTAAGAATGCTAGAATCACCTGTACAAGAAGATAACTAA
Predicted protein sequences of Glyma17g08136
>Glyma17g08136.1   sequence type=predicted peptide   gene model=Glyma17g08136   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MDEFSPRARRRSALLTWQHIASLPPSLPVVYCGGFNTQKESTTGRFLLGRSREHGVVGDMRDAWPSARVRKNVSLIRTYHGFKGDKQGTLEFLKLIFRALCLCWDRQTQDLHIDWILFRGRSLIPVSCEVVNDNIDGYYPSSHFPIFAEFMLPRTVRMLESPVQEDN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo