Glyma17g07790 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g07790

Feature Type:	gene_model
Chromosome:	Gm17
Start:	5760574
stop:	5761847
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g07790

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G30030	AT	Annotation by Michelle Graham. TAIR10: Eukaryotic aspartyl protease family protein \| chr4:14682210-14683484 REVERSE LENGTH=424	SoyBase	E_val: 3.00E-65	ISS
GO:0006508	GO-bp	Annotation by Michelle Graham. GO Biological Process: proteolysis	SoyBase	N/A	ISS
GO:0005576	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: extracellular region	SoyBase	N/A	ISS
GO:0004190	GO-mf	Annotation by Michelle Graham. GO Molecular Function: aspartic-type endopeptidase activity	SoyBase	N/A	ISS
KOG1339	KOG	Aspartyl protease	JGI		ISS
PTHR13683	Panther	ASPARTYL PROTEASES	JGI		ISS
PTHR13683:SF98	Panther	CHLOROPLAST NUCLEIOD DNA-BINDING-RELATED	JGI		ISS
PF00026	PFAM	Eukaryotic aspartyl protease	JGI		ISS
UniRef100_B9T5B0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Aspartic proteinase nepenthesin-1, putative n=1 Tax=Ricinus communis RepID=B9T5B0_RICCO	SoyBase	E_val: 3.00E-79	ISS
UniRef100_I1MSY5	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MSY5_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma17g07790

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g07790

Paralog	Evidence	Comments
Glyma02g36970	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g07790 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.17g070100	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma17g07790

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g07790

Limit To All Plant Sequences

>Glyma17g07790.2   sequence type=CDS   gene model=Glyma17g07790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CTTGTTTATAGACTTGTTTCATTGCCTTTCATATTTCATTTCACCTTAACCACTGCCACCATCATAACCTCATCTATTAACCCAGTGTTTCTCATACACTATGAGTCAACACTATCACTCTACAATTCAAAAGACACCACTTGGGATCATTACTCGCATAAAATGCTTAAGCAAACTTCTAGTAATGAATATATCTCCAATCTTGTTCCTAGCCCTAGAAATGTTGTGTTCTTAATTAATTTCTCCATAGGTGAACCACCTGTTCCATCACTTGCTGTCATGGACACTGGTAGCAGCTTTACATGGGTTATGTGTCATCCTTGTTCATCTTGTTCGCAGCAATCTGTTCCAATATTTGACCTCTCAAAATCTTCCACATATGCTTTGACATTCAGTGAATGTAACAAATGTGATGTGGTGAATTGTGAGTGTCCATGCAGTGTGGAGTATGTTGGGAGTGGTTCATCAAAAGGGATCTATGCAAGGGAGCAATTAACTTCAGAAACCATAGATGAAAACGCATTCAAAGTTCCTAGTTTGATATTTGGATGTGGTCGTGAGTTTAGTACATCATCAAATGGTTACCCCTACCAAGGAATCAATGGGGTGTTTGGACTTGGTAGCGGAAGGTTCTCGTTGCTACCTAGCTTTGGTAACTTAAGAAATATTAATCATAAGTTTAACATATTGGTCTTGGGGGACAAAGCCAATATGCAAGGTGACTTAACTAATTTGAATGTGATCAATGGTTTGTATTATGTTAATCTAGAAGCTATAAGCATAGGAGGGAGAAAGCTTGATATCAATCCAACCGTGTTTGAAAGATCAATAACAGATAATAACAGTGGACTTATAGAATATGGATTTGAAGTGCTTAGCTTTGAAGTTGAGAATCTTCTTGAAGGGGTTTTGGTTTTGGCCCAACAAGATAAGCACAATCCTTATACTTTATGCTATAGTGGTGTGGTAAGCCGGGACCTAAGTGGCTTTCCGTTGGAGACATTTCATTTTGCTGAAGGAGTGAGGACCACAGAGAATGAATTTTGCATGGCTGTGCTTCCAGGGGACTATTTTAGAGATGACTATGAAAGCTTTTCTCCTATTGGAATGTTGGCTCAACAGAATTATAATGTGGGTTATGACTTGAATGGGATGCGTGTGTACTTTCAGAGGTTTGACTGTGAACTTCTTGATGGGTGA

Predicted protein sequences of Glyma17g07790

Limit To All Plant Sequences

>Glyma17g07790.2   sequence type=predicted peptide   gene model=Glyma17g07790   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
LVYRLVSLPFIFHFTLTTATIITSSINPVFLIHYESTLSLYNSKDTTWDHYSHKMLKQTSSNEYISNLVPSPRNVVFLINFSIGEPPVPSLAVMDTGSSFTWVMCHPCSSCSQQSVPIFDLSKSSTYALTFSECNKCDVVNCECPCSVEYVGSGSSKGIYAREQLTSETIDENAFKVPSLIFGCGREFSTSSNGYPYQGINGVFGLGSGRFSLLPSFGNLRNINHKFNILVLGDKANMQGDLTNLNVINGLYYVNLEAISIGGRKLDINPTVFERSITDNNSGLIEYGFEVLSFEVENLLEGVLVLAQQDKHNPYTLCYSGVVSRDLSGFPLETFHFAEGVRTTENEFCMAVLPGDYFRDDYESFSPIGMLAQQNYNVGYDLNGMRVYFQRFDCELLDG*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain