Report for Sequence Feature Glyma17g07470
Feature Type: gene_model
Chromosome: Gm17
Start: 5470843
stop: 5472998
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma17g07470
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G11210 AT
Annotation by Michelle Graham. TAIR10: glutamate receptor 2.5 | chr5:3571214-3574537 REVERSE LENGTH=829
SoyBase E_val: 1.00E-89 ISS
GO:0006810 GO-bp
Annotation by Michelle Graham. GO Biological Process: transport
SoyBase N/A ISS
GO:0006865 GO-bp
Annotation by Michelle Graham. GO Biological Process: amino acid transport
SoyBase N/A ISS
GO:0006874 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular calcium ion homeostasis
SoyBase N/A ISS
GO:0007186 GO-bp
Annotation by Michelle Graham. GO Biological Process: G-protein coupled receptor signaling pathway
SoyBase N/A ISS
GO:0009416 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to light stimulus
SoyBase N/A ISS
GO:0030003 GO-bp
Annotation by Michelle Graham. GO Biological Process: cellular cation homeostasis
SoyBase N/A ISS
GO:0016020 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: membrane
SoyBase N/A ISS
GO:0016021 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane
SoyBase N/A ISS
GO:0004930 GO-mf
Annotation by Michelle Graham. GO Molecular Function: G-protein coupled receptor activity
SoyBase N/A ISS
GO:0004970 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ionotropic glutamate receptor activity
SoyBase N/A ISS
GO:0005215 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transporter activity
SoyBase N/A ISS
GO:0005217 GO-mf
Annotation by Michelle Graham. GO Molecular Function: intracellular ligand-gated ion channel activity
SoyBase N/A ISS
GO:0005234 GO-mf
Annotation by Michelle Graham. GO Molecular Function: extracellular-glutamate-gated ion channel activity
SoyBase N/A ISS
PTHR18966 Panther
IONOTROPIC GLUTAMATE RECEPTOR-RELATED
JGI ISS
PTHR18966:SF6 Panther
gb def: agcp9714 [anopheles gambiae str. pest]
JGI ISS
PF00060 PFAM
Ligand-gated ion channel
JGI ISS
PF00497 PFAM
Bacterial extracellular solute-binding proteins, family 3
JGI ISS
UniRef100_A5AD54 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Glutamate receptor n=1 Tax=Vitis vinifera RepID=A5AD54_VITVI
SoyBase E_val: 5.00E-106 ISS
UniRef100_C6TEI9 UniRef
Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6TEI9_SOYBN
SoyBase E_val: 0 ISS
Expression Patterns of Glyma17g07470
Gene expression representations made with eFP at the University of Toronto. Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE Paralogs of Glyma17g07470
Paralog Evidence Comments
Glyma13g01330 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma17g07470 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.17g067200 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma17g07470
Coding sequences of Glyma17g07470
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma17g07470.2 sequence type=CDS gene model=Glyma17g07470 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGCTAAGTGCTTTTCATTCTCTCTCTCTCGTTTTCTGATCTTTTCGTTTGTGCTGCTACAGACACAAACGGGGAATGGGTCAAATGCAACACCGATCAAGTTGAGAGTAGGGGTACCCAAGAAAGATGGTTTCCGCCAATTTGTGGATGTAGTACCTTCGGACTCTCATGAAAAAAAGTACAACGTATCTGGATATTGCATGGATGTTTTCAATGCCGTTGTTACCCGCTTACCTTTCAAGGTTTCTCTTCATATTCAACAACCTTATGGTATTGAATCAAGTGAGATTTCTGGAACATACGATGCACTTCTCCATCAGATCCCAGCAAAGTACGATGTTGTGGTAGGGGATGTAACAATTCTGGCGAACCGTTCAAATTTCGTAGATTTCACGCTGCCATATACAGGTTCGGGAGTTAAAATGTTAGTACCAGCTCAACATGGGAGGCAACAAGCCATGTGGATTTTCGTGAAACCATTCAGCTGGGAGCTTTGGTTGAGCATAGTCATCATCTCTACCTTCATAGGGTTTTCCATACTCATCATGGAAAGAAATGTAAATGCTCTTCCTGATCACGAGGGTTCGCCAAATCGAGCAAAGCTTAGCCCTGCAACCATCTTATGGTTTCCAATTTCACAAGCCATTCTTCCTGAAAGACAAGTAGTGGCGAAGAACTGCTCGAGATTTGTGTTGATGGTATGGCTTCTATTGGCGTTCGTGCTCATGCAAAGTTACACTGCAAACTTGACTTCTATATTGACTTTGGATCAGTTAAGACCCAGTTTTCTGAACGTAAATGATCTAAGAAAAGGGGGTTATTATGTTGGATATCAAACCGGGTCTTTCGTTAAAGATGTGCTGGTTCATCAATTTAATTTTGACTCGCACAAGCTGAGGGCATACAACACAAGTTCTGAGTATCATGATGCTTTAAAAATGGGAAGCGAAGGTGGGGGTGTTGCAGCTATATTCGACGAATTGCCCTACCTTAAAGTCTACCTTAGAGAATACGGATCCAATTACATCTTGTCGGGCCCAAGATATAGAAATGCTGGGTTTGGTTTTGCATTTCCTTTTAACTCCAATCTCACTGCTGACTTTTCGAGGGCCATCTTGAATGTGACTGAAAGTGATTTAATGAAAGAAATTGAGGAAAAATATTTTGGGAAGAATGATGATATTGGAGGAGAAGAGACGTCTACTGAAATTTCTTCTGCTACTCTAAGTCTCAACTTTCATAGTTTTGCAGGGTTATTCTTGATTACAGGGATTTCTACTTTATTAGCGCTATTGGTCTCAGAAACTGTTATTTGGCAAAGGGCGATTTTGATAGCCAAGGCATACAGTCAGAAGTTTTTGTTCTCCACTCCACCTTCCCCACAAACACGAGTTCATCCAACTCAAGATTCAACGCACGGATCAATAGAGGCCGTTTAA
Predicted protein sequences of Glyma17g07470
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma17g07470.2 sequence type=predicted peptide gene model=Glyma17g07470 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MAKCFSFSLSRFLIFSFVLLQTQTGNGSNATPIKLRVGVPKKDGFRQFVDVVPSDSHEKKYNVSGYCMDVFNAVVTRLPFKVSLHIQQPYGIESSEISGTYDALLHQIPAKYDVVVGDVTILANRSNFVDFTLPYTGSGVKMLVPAQHGRQQAMWIFVKPFSWELWLSIVIISTFIGFSILIMERNVNALPDHEGSPNRAKLSPATILWFPISQAILPERQVVAKNCSRFVLMVWLLLAFVLMQSYTANLTSILTLDQLRPSFLNVNDLRKGGYYVGYQTGSFVKDVLVHQFNFDSHKLRAYNTSSEYHDALKMGSEGGGVAAIFDELPYLKVYLREYGSNYILSGPRYRNAGFGFAFPFNSNLTADFSRAILNVTESDLMKEIEEKYFGKNDDIGGEETSTEISSATLSLNFHSFAGLFLITGISTLLALLVSETVIWQRAILIAKAYSQKFLFSTPPSPQTRVHPTQDSTHGSIEAV*
SoyBase
SoyBase transitions to NEW site on 10/1/2024
