SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g06330

Feature Type:gene_model
Chromosome:Gm17
Start:4497832
stop:4501645
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma17g06330
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G52600AT Annotation by Michelle Graham. TAIR10: Peptidase S24/S26A/S26B/S26C family protein | chr1:19590612-19592486 FORWARD LENGTH=180 SoyBaseE_val: 4.00E-123ISS
GO:0006465GO-bp Annotation by Michelle Graham. GO Biological Process: signal peptide processing SoyBaseN/AISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0034976GO-bp Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0008233GO-mf Annotation by Michelle Graham. GO Molecular Function: peptidase activity SoyBaseN/AISS
KOG3342 KOG Signal peptidase I JGI ISS
PTHR10806Panther PROTEASE FAMILY S26 MICROSOMAL SIGNAL PEPTIDASE SUBUNIT SPC18,21/SEC11(YEAST) JGI ISS
PF00717PFAM Peptidase S24-like JGI ISS
UniRef100_B9RV45UniRef Annotation by Michelle Graham. Most informative UniRef hit: Microsomal signal peptidase 18 kDa subunit, putative n=1 Tax=Ricinus communis RepID=B9RV45_RICCO SoyBaseE_val: 6.00E-123ISS
UniRef100_I1MSH9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1MSH9_SOYBN SoyBaseE_val: 5.00E-134ISS

Expression Patterns of Glyma17g06330
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g06330 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g055700 Wm82.a2.v1IGC As supplied by JGI

References for Glyma17g06330
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma17g06330
>Glyma17g06330.1   sequence type=CDS   gene model=Glyma17g06330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAGACAGAAAGGAAGCAATAGCAATAACAATGGGTTGGATAGGTGAGAGTGTTGATTCCATCAAATCTCTTCAGATCCGCCAGGTCCTCACCCAGGCTGTTAGCCTCGGCATGATTGTTACCTCTGCACTGATAATATGGAAGGCATTGATGTGCATTACTGGCAGTGAATCTCCTGTTGTTGTTGTTCTTTCTGGAAGCATGGAACCCGGATTCAAGCGGGGAGACATCTTATTCTTGCACATGAGTAAAGACCCAATTCGGGCAGGGGAGATTGTTGTGTTTAATGTCGATGGACGTGAGATTCCAATTGTTCATCGTGTAATTAAGGTACATGAGAGGGAAGATACTGGGGAGGTTGATGTTCTCACTAAAGGAGACAACAATTATGGTGATGACAGGCTACTGTATGCTCACGGTCAACTTTGGCTGCAAAGGCACCACATTATGGGTAGAGCCGTCGGGTTCTTACCTTACGTAGGCTGGGTGACCATCATTATGACTGAAAAGCCTATTATCAAGTATATTCTCATTGGTGCTTTGGGGTTGCTCGTGATAACTTCGAAAGATTAA
Predicted protein sequences of Glyma17g06330
>Glyma17g06330.1   sequence type=predicted peptide   gene model=Glyma17g06330   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGDRKEAIAITMGWIGESVDSIKSLQIRQVLTQAVSLGMIVTSALIIWKALMCITGSESPVVVVLSGSMEPGFKRGDILFLHMSKDPIRAGEIVVFNVDGREIPIVHRVIKVHEREDTGEVDVLTKGDNNYGDDRLLYAHGQLWLQRHHIMGRAVGFLPYVGWVTIIMTEKPIIKYILIGALGLLVITSKD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo