SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g06251

Feature Type:gene_model
Chromosome:Gm17
Start:4439065
stop:4441204
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma17g06251
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G56890AT Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein | chr5:23010801-23015559 REVERSE LENGTH=1113 SoyBaseE_val: 3.00E-49ISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0004713GO-mf Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
PTHR24420Panther FAMILY NOT NAMED JGI ISS
PTHR24420:SF801Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
PF07714PFAM Protein tyrosine kinase JGI ISS
UniRef100_A2Q551UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein kinase n=1 Tax=Medicago truncatula RepID=A2Q551_MEDTR SoyBaseE_val: 1.00E-56ISS
UniRef100_I1MSH0UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1MSH0_SOYBN SoyBaseE_val: 8.00E-100ISS

Expression Patterns of Glyma17g06251
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g06251 not represented in the dataset
Glyma17g06251 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma17g06251 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g054800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma17g06251
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma17g06251
>Glyma17g06251.1   sequence type=CDS   gene model=Glyma17g06251   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAATTTCATAGGTACTGCTGGATCATTTAGAGGCGCGGGAACTGGTTCTGTTTCCACACTTAACGGTACGAAAGACATCGAGAAAGCAACTGATAATTTCCATGCTTCAAGAATACCTGGAGAGGGGGTTTTTGGCCTTGTTTACAGTGGTATCCTTGAAGATGGGATGAAAGTGGCATTCAAGGTTCTAAAAAGGGAGGACCCTCATGGTGATCATGAATTCTTAGCTGAAGTTGAGATGCTTAGTCGTCTTCACCATAGAAATTTGGTCAAGTTAATTGGGGTTGACAGGGAAATCAGCCCCCTTGATTGGGGTGCCCGGATGAAAATAGCTCTTGGAGCAGCTCCTGGTCTTGCTTATCTGCATGAAGATTCAAGTCCTCGTGTTATACATAGGGACTTCAAGTCTAGCAACATATTGTTGGATTGGCTTGAACGGCATCGGATGGGGAGAACAAACACATATCAACTCGTGTCATGGGAAGTTTTGGGAACAACCGAACAAGTGATGAATTTGAATCCATGA
Predicted protein sequences of Glyma17g06251
>Glyma17g06251.1   sequence type=predicted peptide   gene model=Glyma17g06251   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MNFIGTAGSFRGAGTGSVSTLNGTKDIEKATDNFHASRIPGEGVFGLVYSGILEDGMKVAFKVLKREDPHGDHEFLAEVEMLSRLHHRNLVKLIGVDREISPLDWGARMKIALGAAPGLAYLHEDSSPRVIHRDFKSSNILLDWLERHRMGRTNTYQLVSWEVLGTTEQVMNLNP*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo