SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma17g06020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma17g06020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma17g06020

Feature Type:gene_model
Chromosome:Gm17
Start:4243672
stop:4249554
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma17g06020
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G29810AT Annotation by Michelle Graham. TAIR10: MAP kinase kinase 2 | chr4:14593299-14595241 REVERSE LENGTH=363 SoyBaseE_val: 0ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007154GO-bp Annotation by Michelle Graham. GO Biological Process: cell communication SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009627GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance SoyBaseN/AISS
GO:0009631GO-bp Annotation by Michelle Graham. GO Biological Process: cold acclimation SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009814GO-bp Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0010374GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex development SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0034976GO-bp Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0045088GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051707GO-bp Annotation by Michelle Graham. GO Biological Process: response to other organism SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004674GO-mf Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity SoyBaseN/AISS
GO:0004708GO-mf Annotation by Michelle Graham. GO Molecular Function: MAP kinase kinase activity SoyBaseN/AISS
GO:0004713GO-mf Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
GO:0016772GO-mf Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups SoyBaseN/AISS
KOG0581 KOG Mitogen-activated protein kinase kinase (MAP2K) JGI ISS
PTHR24360Panther MAPKK/MEKK JGI ISS
PTHR24360:SF39Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_Q5JCL0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Mitogen-activated protein kinase kinase MAPKK2 n=1 Tax=Glycine max RepID=Q5JCL0_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q5JCL0UniRef Annotation by Michelle Graham. Best UniRef hit: Mitogen-activated protein kinase kinase MAPKK2 n=1 Tax=Glycine max RepID=Q5JCL0_SOYBN SoyBaseE_val: 0ISS

Proteins Associated with Glyma17g06020
LocusGene SymbolProtein Name
MKK2a Mitogen-activated protein kinase kinase 2 gene a

Expression Patterns of Glyma17g06020
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma17g06020 not represented in the dataset
Glyma17g06020 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g06020
ParalogEvidenceComments
Glyma13g16650 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g06020 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.17g052400 Wm82.a2.v1IGC As supplied by JGI

References for Glyma17g06020
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma17g06020
>Glyma17g06020.1   sequence type=CDS   gene model=Glyma17g06020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGAAAGGAAACTTGGGTCTTGGTCTCAAACTCTCAGTTCCTGTGTCTGATCAATCTAATTTTGCCAAGTTCCTGACTGAAAGTGGGACTTTTAAGGATGGGGATCTGCTTGTCAACAGGGATGGAGTTCGAATTGTCTCTCAGAATGATGTCGAAGCTCCACCTCCAATCAAGCCTACAGACAACCAGTTAGCTTTAGCAGACATAGATGTAATCAAAGTTGTTGGAAAGGGAAATGGAGGGGTAGTCCAATTGGTACAACACAAATGGACTAGTCAGTTTTTTGCGTTGAAGGTAATTCAGATGAATATTGAGGAGTCTATGCGCAAGCAGATTACACAAGAGCTGAAAATTAATCAACAAGCACAATGCCCTTATGTTGTTGTCTGTTACCAATCATTCTATGAAAACGGTGTCATATCAATCATCTTAGAGTACATGGATGGAGGTTCCTTAGCTGATCTGCTGAAGAAAGTTAAAACAATTCCAGAGTCTTATCTTGCTGCCATCTGTAAGCAGGTGCTGAAGGGTCTAGTTTATCTCCACCACGAAAGGCATATTATCCACAGAGACTTAAAACCTTCTAATTTGTTAATAAATCATATTGGTGAAGTAAAGATCACTGACTTTGGTGTGAGTGCAATTATGGAAAGTACATCTGGTCAAGCAAATACTTTCATTGGAACCTGCAACTATATGTCTCCAGAGAGAATCAATGGAAGCCAGGAAGGCTACAACTTCAAAAGTGATATATGGAGTTTGGGACTAATATTACTTGAGTGTGCTTTGGGTCGGTTTCCATATGCACCGCCTGATCAAAGCGAAACATGGGAAAGCATTTATGAGCTTATTGAAGCCATTGTTGAGAAACCTCCTCCTAGTCCTCCATCTGAACAATTTTCTACAGAATTTTGCTCATTTATCTCTGCATGTCTTCAGAAAGACCCAAAGGATCGGCTGTCAGCTCAGGAATTAATGGCACATCCTTTTGTCAACATGTATGATGACTTGGAAGTGGATCTTTCAGCTTACTTCTCGAATGCAGGATCTCCTCTTGCAACCTTATAA
Predicted protein sequences of Glyma17g06020
>Glyma17g06020.1   sequence type=predicted peptide   gene model=Glyma17g06020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKKGNLGLGLKLSVPVSDQSNFAKFLTESGTFKDGDLLVNRDGVRIVSQNDVEAPPPIKPTDNQLALADIDVIKVVGKGNGGVVQLVQHKWTSQFFALKVIQMNIEESMRKQITQELKINQQAQCPYVVVCYQSFYENGVISIILEYMDGGSLADLLKKVKTIPESYLAAICKQVLKGLVYLHHERHIIHRDLKPSNLLINHIGEVKITDFGVSAIMESTSGQANTFIGTCNYMSPERINGSQEGYNFKSDIWSLGLILLECALGRFPYAPPDQSETWESIYELIEAIVEKPPPSPPSEQFSTEFCSFISACLQKDPKDRLSAQELMAHPFVNMYDDLEVDLSAYFSNAGSPLATL*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo