Glyma17g06020 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma17g06020

Feature Type:	gene_model
Chromosome:	Gm17
Start:	4243672
stop:	4249554
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma17g06020

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT4G29810	AT	Annotation by Michelle Graham. TAIR10: MAP kinase kinase 2 \| chr4:14593299-14595241 REVERSE LENGTH=363	SoyBase	E_val: 0	ISS
GO:0000165	GO-bp	Annotation by Michelle Graham. GO Biological Process: MAPK cascade	SoyBase	N/A	ISS
GO:0006096	GO-bp	Annotation by Michelle Graham. GO Biological Process: glycolysis	SoyBase	N/A	ISS
GO:0006355	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent	SoyBase	N/A	ISS
GO:0006468	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein phosphorylation	SoyBase	N/A	ISS
GO:0006612	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane	SoyBase	N/A	ISS
GO:0006833	GO-bp	Annotation by Michelle Graham. GO Biological Process: water transport	SoyBase	N/A	ISS
GO:0006970	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to osmotic stress	SoyBase	N/A	ISS
GO:0006972	GO-bp	Annotation by Michelle Graham. GO Biological Process: hyperosmotic response	SoyBase	N/A	ISS
GO:0007030	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi organization	SoyBase	N/A	ISS
GO:0007154	GO-bp	Annotation by Michelle Graham. GO Biological Process: cell communication	SoyBase	N/A	ISS
GO:0009266	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus	SoyBase	N/A	ISS
GO:0009409	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cold	SoyBase	N/A	ISS
GO:0009595	GO-bp	Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus	SoyBase	N/A	ISS
GO:0009617	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to bacterium	SoyBase	N/A	ISS
GO:0009627	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance	SoyBase	N/A	ISS
GO:0009631	GO-bp	Annotation by Michelle Graham. GO Biological Process: cold acclimation	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0009697	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009738	GO-bp	Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009814	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response, incompatible interaction	SoyBase	N/A	ISS
GO:0009862	GO-bp	Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009863	GO-bp	Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0009867	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway	SoyBase	N/A	ISS
GO:0010200	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to chitin	SoyBase	N/A	ISS
GO:0010310	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process	SoyBase	N/A	ISS
GO:0010363	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response	SoyBase	N/A	ISS
GO:0010374	GO-bp	Annotation by Michelle Graham. GO Biological Process: stomatal complex development	SoyBase	N/A	ISS
GO:0030968	GO-bp	Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response	SoyBase	N/A	ISS
GO:0031348	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response	SoyBase	N/A	ISS
GO:0034976	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to endoplasmic reticulum stress	SoyBase	N/A	ISS
GO:0035304	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation	SoyBase	N/A	ISS
GO:0035556	GO-bp	Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction	SoyBase	N/A	ISS
GO:0042742	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to bacterium	SoyBase	N/A	ISS
GO:0043069	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death	SoyBase	N/A	ISS
GO:0043900	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process	SoyBase	N/A	ISS
GO:0045088	GO-bp	Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response	SoyBase	N/A	ISS
GO:0046686	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to cadmium ion	SoyBase	N/A	ISS
GO:0048481	GO-bp	Annotation by Michelle Graham. GO Biological Process: ovule development	SoyBase	N/A	ISS
GO:0050832	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response to fungus	SoyBase	N/A	ISS
GO:0051707	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to other organism	SoyBase	N/A	ISS
GO:0005737	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0004672	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein kinase activity	SoyBase	N/A	ISS
GO:0004674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity	SoyBase	N/A	ISS
GO:0004708	GO-mf	Annotation by Michelle Graham. GO Molecular Function: MAP kinase kinase activity	SoyBase	N/A	ISS
GO:0004713	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity	SoyBase	N/A	ISS
GO:0005515	GO-mf	Annotation by Michelle Graham. GO Molecular Function: protein binding	SoyBase	N/A	ISS
GO:0005524	GO-mf	Annotation by Michelle Graham. GO Molecular Function: ATP binding	SoyBase	N/A	ISS
GO:0016301	GO-mf	Annotation by Michelle Graham. GO Molecular Function: kinase activity	SoyBase	N/A	ISS
GO:0016772	GO-mf	Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups	SoyBase	N/A	ISS
KOG0581	KOG	Mitogen-activated protein kinase kinase (MAP2K)	JGI		ISS
PTHR24360	Panther	MAPKK/MEKK	JGI		ISS
PTHR24360:SF39	Panther		JGI		ISS
PF00069	PFAM	Protein kinase domain	JGI		ISS
UniRef100_Q5JCL0	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Mitogen-activated protein kinase kinase MAPKK2 n=1 Tax=Glycine max RepID=Q5JCL0_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q5JCL0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Mitogen-activated protein kinase kinase MAPKK2 n=1 Tax=Glycine max RepID=Q5JCL0_SOYBN	SoyBase	E_val: 0	ISS

Proteins Associated with Glyma17g06020

Locus	Gene Symbol	Protein Name
	MKK2a	Mitogen-activated protein kinase kinase 2 gene a

Expression Patterns of Glyma17g06020

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma17g06020

Paralog	Evidence	Comments
Glyma13g16650	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma17g06020 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.17g052400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma17g06020

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma17g06020

Limit To All Plant Sequences

>Glyma17g06020.1   sequence type=CDS   gene model=Glyma17g06020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGAAAGGAAACTTGGGTCTTGGTCTCAAACTCTCAGTTCCTGTGTCTGATCAATCTAATTTTGCCAAGTTCCTGACTGAAAGTGGGACTTTTAAGGATGGGGATCTGCTTGTCAACAGGGATGGAGTTCGAATTGTCTCTCAGAATGATGTCGAAGCTCCACCTCCAATCAAGCCTACAGACAACCAGTTAGCTTTAGCAGACATAGATGTAATCAAAGTTGTTGGAAAGGGAAATGGAGGGGTAGTCCAATTGGTACAACACAAATGGACTAGTCAGTTTTTTGCGTTGAAGGTAATTCAGATGAATATTGAGGAGTCTATGCGCAAGCAGATTACACAAGAGCTGAAAATTAATCAACAAGCACAATGCCCTTATGTTGTTGTCTGTTACCAATCATTCTATGAAAACGGTGTCATATCAATCATCTTAGAGTACATGGATGGAGGTTCCTTAGCTGATCTGCTGAAGAAAGTTAAAACAATTCCAGAGTCTTATCTTGCTGCCATCTGTAAGCAGGTGCTGAAGGGTCTAGTTTATCTCCACCACGAAAGGCATATTATCCACAGAGACTTAAAACCTTCTAATTTGTTAATAAATCATATTGGTGAAGTAAAGATCACTGACTTTGGTGTGAGTGCAATTATGGAAAGTACATCTGGTCAAGCAAATACTTTCATTGGAACCTGCAACTATATGTCTCCAGAGAGAATCAATGGAAGCCAGGAAGGCTACAACTTCAAAAGTGATATATGGAGTTTGGGACTAATATTACTTGAGTGTGCTTTGGGTCGGTTTCCATATGCACCGCCTGATCAAAGCGAAACATGGGAAAGCATTTATGAGCTTATTGAAGCCATTGTTGAGAAACCTCCTCCTAGTCCTCCATCTGAACAATTTTCTACAGAATTTTGCTCATTTATCTCTGCATGTCTTCAGAAAGACCCAAAGGATCGGCTGTCAGCTCAGGAATTAATGGCACATCCTTTTGTCAACATGTATGATGACTTGGAAGTGGATCTTTCAGCTTACTTCTCGAATGCAGGATCTCCTCTTGCAACCTTATAA

Predicted protein sequences of Glyma17g06020

Limit To All Plant Sequences

>Glyma17g06020.1   sequence type=predicted peptide   gene model=Glyma17g06020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKKGNLGLGLKLSVPVSDQSNFAKFLTESGTFKDGDLLVNRDGVRIVSQNDVEAPPPIKPTDNQLALADIDVIKVVGKGNGGVVQLVQHKWTSQFFALKVIQMNIEESMRKQITQELKINQQAQCPYVVVCYQSFYENGVISIILEYMDGGSLADLLKKVKTIPESYLAAICKQVLKGLVYLHHERHIIHRDLKPSNLLINHIGEVKITDFGVSAIMESTSGQANTFIGTCNYMSPERINGSQEGYNFKSDIWSLGLILLECALGRFPYAPPDQSETWESIYELIEAIVEKPPPSPPSEQFSTEFCSFISACLQKDPKDRLSAQELMAHPFVNMYDDLEVDLSAYFSNAGSPLATL*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain