Report for Sequence Feature Glyma17g04490
Feature Type: gene_model
Chromosome: Gm17
Start: 3003239
stop: 3003316
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma17g04490
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT3G57770 AT
Annotation by Michelle Graham. TAIR10: Protein kinase superfamily protein | chr3:21397542-21398421 FORWARD LENGTH=269
SoyBase E_val: 5.00E-11 ISS
GO:0006468 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein phosphorylation
SoyBase N/A ISS
GO:0005886 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane
SoyBase N/A ISS
GO:0004672 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein kinase activity
SoyBase N/A ISS
GO:0004674 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein serine/threonine kinase activity
SoyBase N/A ISS
GO:0004713 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein tyrosine kinase activity
SoyBase N/A ISS
GO:0005524 GO-mf
Annotation by Michelle Graham. GO Molecular Function: ATP binding
SoyBase N/A ISS
GO:0016301 GO-mf
Annotation by Michelle Graham. GO Molecular Function: kinase activity
SoyBase N/A ISS
GO:0016772 GO-mf
Annotation by Michelle Graham. GO Molecular Function: transferase activity, transferring phosphorus-containing groups
SoyBase N/A ISS
UniRef100_G7IDG7 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Protein kinase-like protein n=1 Tax=Medicago truncatula RepID=G7IDG7_MEDTR
SoyBase E_val: 8.00E-09 ISS
UniRef100_G7IDG7 UniRef
Annotation by Michelle Graham. Best UniRef hit: Protein kinase-like protein n=1 Tax=Medicago truncatula RepID=G7IDG7_MEDTR
SoyBase E_val: 8.00E-09 ISS
Expression Patterns of Glyma17g04490
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Gene model name correspondences to Glyma17g04490 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
References for Glyma17g04490
Coding sequences of Glyma17g04490
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma17g04490.1 sequence type=CDS gene model=Glyma17g04490 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGTCCACATATCAGATATTAAACTGATAAGAACAGATACTACACTTGATCTTAGCCAAAAGGCCGAGAAAGGTATG
Predicted protein sequences of Glyma17g04490
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma17g04490.1 sequence type=predicted peptide gene model=Glyma17g04490 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MVHISDIKLIRTDTTLDLSQKAEKGM