SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g33360): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g33360): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g33360

Feature Type:gene_model
Chromosome:Gm16
Start:36304083
stop:36306494
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G55620AT Annotation by Michelle Graham. TAIR10: Translation initiation factor IF6 | chr3:20634581-20636312 FORWARD LENGTH=245 SoyBaseE_val: 4.00E-116ISS
GO:0006413GO-bp Annotation by Michelle Graham. GO Biological Process: translational initiation SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0042256GO-bp Annotation by Michelle Graham. GO Biological Process: mature ribosome assembly SoyBaseN/AISS
GO:0071215GO-bp Annotation by Michelle Graham. GO Biological Process: cellular response to abscisic acid stimulus SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005730GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleolus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003743GO-mf Annotation by Michelle Graham. GO Molecular Function: translation initiation factor activity SoyBaseN/AISS
GO:0043022GO-mf Annotation by Michelle Graham. GO Molecular Function: ribosome binding SoyBaseN/AISS
KOG3185 KOG Translation initiation factor 6 (eIF-6) JGI ISS
PTHR10784Panther TRANSLATION INITIATION FACTOR 6 JGI ISS
PF01912PFAM eIF-6 family JGI ISS
UniRef100_I1MQC6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1MQC6_SOYBN SoyBaseE_val: 5.00E-151ISS
UniRef100_I1MQC8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Eukaryotic translation initiation factor 6 4 n=1 Tax=Glycine max RepID=I1MQC8_SOYBN SoyBaseE_val: 9.00E-118ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g33360 not represented in the dataset

Glyma16g33360 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g208500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g33360.1   sequence type=CDS   gene model=Glyma16g33360   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
CTTCAGTTTGAAAATAATTGTGAAGTTGGAGCCTTCTCTAAACTTACCAATGCCTACTGTTTGGTTGCCATTGGAGGTTCTGAAAACTTCTACAGTTTATTTGAAGCCGAGTTAGCAGGTGTTATCCCTGTGGTCAAGACATCCATTAGTGGTATTCGTGTTATTGGTCATCTTTGTGCTGGAAACAAGAATGGGCTTCTCTTGCCCCATACCACCACAGACCAAGAACTTCAACATTTGAGAAACAGTCTACCTGATCAAGTTGTTCAGCGGATAGAAGAAAGGTTATGTTCTCTGGGAAATTGTATAGCATGTAATGACCATGTGGCCCTCGCTCACACTGATCTTGATAGGGAGACCGAGGAGATTATTGGAGATGTTCTTGGAGTAGAAGTTTTCCGGCATACCATTGCTGATAATATTATGGTTGGTAGTTACTGTGCCTTCTCCAACAGAGGTGGTTTGAAGACTTGGATGAACTTTCTACTCTTCTTCAGGTTCCTTTGTGGTTCAGACACCACAGCAACAGAGCTATCTGTGATTGAGAGTGTTTTCAAGCTAAGAGAAGCACAGCATAGTGCCATTGTGGATGAGATGAGGAAATCCCTCATTGATACCTATGTCTGA

>Glyma16g33360.1   sequence type=predicted peptide   gene model=Glyma16g33360   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
LQFENNCEVGAFSKLTNAYCLVAIGGSENFYSLFEAELAGVIPVVKTSISGIRVIGHLCAGNKNGLLLPHTTTDQELQHLRNSLPDQVVQRIEERLCSLGNCIACNDHVALAHTDLDRETEEIIGDVLGVEVFRHTIADNIMVGSYCAFSNRGGLKTWMNFLLFFRFLCGSDTTATELSVIESVFKLREAQHSAIVDEMRKSLIDTYV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo