SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g32931): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g32931): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g32931

Feature Type:gene_model
Chromosome:Gm16
Start:36024642
stop:36029111
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT5G51600AT Annotation by Michelle Graham. TAIR10: Microtubule associated protein (MAP65/ASE1) family protein | chr5:20961061-20964080 REVERSE LENGTH=707 SoyBaseE_val: 2.00E-135ISS
GO:0000087GO-bp Annotation by Michelle Graham. GO Biological Process: M phase of mitotic cell cycle SoyBaseN/AISS
GO:0000226GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule cytoskeleton organization SoyBaseN/AISS
GO:0000278GO-bp Annotation by Michelle Graham. GO Biological Process: mitotic cell cycle SoyBaseN/AISS
GO:0000280GO-bp Annotation by Michelle Graham. GO Biological Process: nuclear division SoyBaseN/AISS
GO:0000911GO-bp Annotation by Michelle Graham. GO Biological Process: cytokinesis by cell plate formation SoyBaseN/AISS
GO:0006275GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of DNA replication SoyBaseN/AISS
GO:0006342GO-bp Annotation by Michelle Graham. GO Biological Process: chromatin silencing SoyBaseN/AISS
GO:0007000GO-bp Annotation by Michelle Graham. GO Biological Process: nucleolus organization SoyBaseN/AISS
GO:0007129GO-bp Annotation by Michelle Graham. GO Biological Process: synapsis SoyBaseN/AISS
GO:0007131GO-bp Annotation by Michelle Graham. GO Biological Process: reciprocal meiotic recombination SoyBaseN/AISS
GO:0008283GO-bp Annotation by Michelle Graham. GO Biological Process: cell proliferation SoyBaseN/AISS
GO:0009624GO-bp Annotation by Michelle Graham. GO Biological Process: response to nematode SoyBaseN/AISS
GO:0010389GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of G2/M transition of mitotic cell cycle SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0016572GO-bp Annotation by Michelle Graham. GO Biological Process: histone phosphorylation SoyBaseN/AISS
GO:0022402GO-bp Annotation by Michelle Graham. GO Biological Process: cell cycle process SoyBaseN/AISS
GO:0042023GO-bp Annotation by Michelle Graham. GO Biological Process: DNA endoreduplication SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0046785GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule polymerization SoyBaseN/AISS
GO:0051225GO-bp Annotation by Michelle Graham. GO Biological Process: spindle assembly SoyBaseN/AISS
GO:0051258GO-bp Annotation by Michelle Graham. GO Biological Process: protein polymerization SoyBaseN/AISS
GO:0051322GO-bp Annotation by Michelle Graham. GO Biological Process: anaphase SoyBaseN/AISS
GO:0051567GO-bp Annotation by Michelle Graham. GO Biological Process: histone H3-K9 methylation SoyBaseN/AISS
GO:0052096GO-bp Annotation by Michelle Graham. GO Biological Process: formation by symbiont of syncytium involving giant cell for nutrient acquisition from host SoyBaseN/AISS
GO:0005874GO-cc Annotation by Michelle Graham. GO Cellular Compartment: microtubule SoyBaseN/AISS
GO:0009524GO-cc Annotation by Michelle Graham. GO Cellular Compartment: phragmoplast SoyBaseN/AISS
GO:0009574GO-cc Annotation by Michelle Graham. GO Cellular Compartment: preprophase band SoyBaseN/AISS
GO:0055028GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cortical microtubule SoyBaseN/AISS
GO:0008017GO-mf Annotation by Michelle Graham. GO Molecular Function: microtubule binding SoyBaseN/AISS
PTHR19321Panther PROTEIN REGULATOR OF CYTOKINESIS 1 PRC1-RELATED JGI ISS
PF03999PFAM Microtubule associated protein (MAP65/ASE1 family) JGI ISS
UniRef100_G7L6B0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Protein regulator of cytokinesis n=1 Tax=Medicago truncatula RepID=G7L6B0_MEDTR SoyBaseE_val: 3.00E-156ISS
UniRef100_I1MQ87UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MQ87_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g32931 not represented in the dataset

Glyma16g32931 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma09g28070 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g204300 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g32931.1   sequence type=CDS   gene model=Glyma16g32931   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGTTTAAATCTGTTGCAGGTATCTGCTCAGCAATGGGAGAGCGACCAGTACATGTTAGGCAGTTTGACCAAAAAGCTGTAAGCTTGAAAGAAGAGCTAGCAAGAGTTTGCCCAGAGCTGGAAGAAATGCAAGAAAGGAAGTCTGAGCGTAGAAATCAATTTATAGAAGTTCAAGAACAGATTCAAAGTATCACAAATGAGATTTATAGTCCAAGTATTACAGCTTCTGTAGATGAAACTGATTTATCATTGAGAAAGCTTGAAGAATTCCAGACAGCTTTTTGCATTTCAAAAGGAGAAGTGAGCGCCTCAAGAAGTTTCAAGACCGACCAACTGACTACCTTAAATTCTCTCTGTTCAGTGCTTGTCTTGGACTTAGCAGATAAGGGACCTAGGAGTGTAAATAATGATACCATTAATCAATTGCCAATTGCTATACAAGACCTGCAAAAAGTTAAATTACAGAGAATGCAAAGGCTCCAAGATCCAGCTTCAACAATGTTGGAGCTCTGGAATTTGATGGATACACCTCTGGAAGAGCAACGGATGTTTCAGAATTTTACTTTATATACGTTAGAAGAGTTAAAATCAAGCAAAATGAAAGAGCTTGTTTTGAAGAAAAGAGCAGAGCTTGAGGAGATTTGTCAAAAGACTCATTTGATTCCAGAAATTGATAGTGCAGTGAAATATGTTGTTGAAGCTACAGAATCTGGATCTGTGGACCCTGCTATTGTGCTTGAACAAATTGAACTTCAGATTGCCCAAGTAAAAGAGGAAGCTTTTGTCAGAAAAGAAATACTTGAAAAAGTTGAGAAATGGTTGTCAGCATGTGATGAAGAATATTGGCTTGAGGAGTACAACAGCGACGAAAATCGATACAATGCTGGGAGAGGTTCTTATCTTACTCTCAAGCGAGCCAAGAAAGCCTGTGCCCTGGTTAAAAAACTTCCAGCAATGGTAGATGCTTTAACTTCAAAAACTGTAGCATCAGAAAAGGACAAAGGCATTGAGTTCACATATGATGGTACCTGTCTGGTCTGTATGCTTGAGAACTACTCCCTATCACGGCAAGAGAAGGAGCAAGAGCGTTGTAGGCAGTGGGAACTGAAGAAACTTCAGGGACAAATAATAGTGGAAAAGGAGAAGATGATTCTCTACCGGATTCTCCCAACTACTCTTCATGATGACTTTTTGTGTGTTCCTGACGTGGTATCTCCTTTGACTCGACAACCTTTTTGTCCCATCTCTTCAACAGTATCGTCGAAAGCGAATGTTGCATTTGCTGCAAATGATACACATAATGAGAAGTTGCAGAAAACATTAGTAGTTAGCAATTTTCCATCCATCACTACTTCAAAGACAACCACAGTGGTGGATAAGAGAACAAAACTCCAAAGGGCAGTATCCATTCCTGACCCCACTACACCATAG

>Glyma16g32931.1   sequence type=predicted peptide   gene model=Glyma16g32931   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEFKSVAGICSAMGERPVHVRQFDQKAVSLKEELARVCPELEEMQERKSERRNQFIEVQEQIQSITNEIYSPSITASVDETDLSLRKLEEFQTAFCISKGEVSASRSFKTDQLTTLNSLCSVLVLDLADKGPRSVNNDTINQLPIAIQDLQKVKLQRMQRLQDPASTMLELWNLMDTPLEEQRMFQNFTLYTLEELKSSKMKELVLKKRAELEEICQKTHLIPEIDSAVKYVVEATESGSVDPAIVLEQIELQIAQVKEEAFVRKEILEKVEKWLSACDEEYWLEEYNSDENRYNAGRGSYLTLKRAKKACALVKKLPAMVDALTSKTVASEKDKGIEFTYDGTCLVCMLENYSLSRQEKEQERCRQWELKKLQGQIIVEKEKMILYRILPTTLHDDFLCVPDVVSPLTRQPFCPISSTVSSKANVAFAANDTHNEKLQKTLVVSNFPSITTSKTTTVVDKRTKLQRAVSIPDPTTP*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo