SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g32910): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g32910): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g32910

Feature Type:gene_model
Chromosome:Gm16
Start:36010254
stop:36014539
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G25370AT Annotation by Michelle Graham. TAIR10: Double Clp-N motif protein | chr4:12972747-12974580 FORWARD LENGTH=238 SoyBaseE_val: 4.00E-88ISS
GO:0019538GO-bp Annotation by Michelle Graham. GO Biological Process: protein metabolic process SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009532GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid stroma SoyBaseN/AISS
GO:0009570GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast stroma SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009941GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast envelope SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
PTHR11638Panther ATP-DEPENDENT CLP PROTEASE JGI ISS
PTHR11638:SF62Panther SUBFAMILY NOT NAMED JGI ISS
PF02861PFAM Clp amino terminal domain JGI ISS
UniRef100_C6TDF0UniRef Annotation by Michelle Graham. Best UniRef hit: Putative uncharacterized protein n=1 Tax=Glycine max RepID=C6TDF0_SOYBN SoyBaseE_val: 0ISS
UniRef100_D7MG14UniRef Annotation by Michelle Graham. Most informative UniRef hit: Clp amino terminal domain-containing protein n=1 Tax=Arabidopsis lyrata subsp. lyrata RepID=D7MG14_ARALL SoyBaseE_val: 1.00E-86ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g32910 not represented in the dataset

Glyma16g32910 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma09g28050 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g204100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g32910.2   sequence type=CDS   gene model=Glyma16g32910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAAGCTTCCACTCTACCCTTTTGCCCAACCCATCTCCCCAAAACCTCTCATTTCTCTCTTCATCTCCTTCCAATGGCTTCCATTCCCACACTCTCTTCACCCCTACCCACAATCTCTGCTCACTCCTCACCCCATTCAAACCCAAACAACCACTGCACTCTCTCTCCCACCTCTCTCTTCGGCACCAGGATCACCCTCCTACGCGCCACCTCATCGTCTCGTTCCCTCCCCAACACCAATTGCCGTGCGACATCAGCCACCGTGTCGTTTAGCCTCCCCACCCCGAAACCCCTTTCAGATACGCCTGAGAAAACCCCAAAGTGGTCGGCGAGGGCTATAAAGTCATATGCAATGGGGGAATTGGAAGCGAGGAAGCTCAAGTATCCAAACACGGGAACCGAGGCACTTCTCATGGGGATTTTGGTTGAAGGAACAAGTAAAGCTGCAAAATTCTTAAGAGCTAATGGAATTACTCTTTTCAAAGTACGTGAAGAAACAGTAGAGCTACTAGGGAAATCTGATTTGTATTTCTTCAGCCCTGAGCATCCTCCATTGACTGAACCAGCCCAGAAAGCCCTTGATTGGGCAATCGAGGAGAAATTGAAGTCAGGTGAAGGAGGAGAAATAAACGTGACACATTTACTTCTAGGAATTTGGTCACAGAAAGAATCAGCAGGTCAACAGATCTTGGATACTCTAGGTTTCAATGATGAAAAAGCCAAAGAACTTGCTAAAACAATTGATGGGGATGTTGATTTGAGTTTCAAAAGGCAAGCTTAA

>Glyma16g32910.2   sequence type=predicted peptide   gene model=Glyma16g32910   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKASTLPFCPTHLPKTSHFSLHLLPMASIPTLSSPLPTISAHSSPHSNPNNHCTLSPTSLFGTRITLLRATSSSRSLPNTNCRATSATVSFSLPTPKPLSDTPEKTPKWSARAIKSYAMGELEARKLKYPNTGTEALLMGILVEGTSKAAKFLRANGITLFKVREETVELLGKSDLYFFSPEHPPLTEPAQKALDWAIEEKLKSGEGGEINVTHLLLGIWSQKESAGQQILDTLGFNDEKAKELAKTIDGDVDLSFKRQA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo