SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g31873): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g31873): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g31873

Feature Type:gene_model
Chromosome:Gm16
Start:35135542
stop:35139375
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G48890AT Annotation by Michelle Graham. TAIR10: membrane-associated progesterone binding protein 3 | chr3:18129669-18131353 FORWARD LENGTH=233 SoyBaseE_val: 2.00E-90ISS
GO:0009684GO-bp Annotation by Michelle Graham. GO Biological Process: indoleacetic acid biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0048523GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of cellular process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005783GO-cc Annotation by Michelle Graham. GO Cellular Compartment: endoplasmic reticulum SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0020037GO-mf Annotation by Michelle Graham. GO Molecular Function: heme binding SoyBaseN/AISS
KOG1110 KOG Putative steroid membrane receptor Hpr6.6/25-Dx JGI ISS
PTHR10281Panther MEMBRANE ASSOCIATED PROGESTERONE RECEPTOR-RELATED JGI ISS
PTHR10281:SF26Panther MEMBRANE STEROID BINDING PROTEIN JGI ISS
PF00173PFAM Cytochrome b5-like Heme/Steroid binding domain JGI ISS
UniRef100_G7KLJ7UniRef Annotation by Michelle Graham. Most informative UniRef hit: Membrane steroid-binding protein n=1 Tax=Medicago truncatula RepID=G7KLJ7_MEDTR SoyBaseE_val: 1.00E-111ISS
UniRef100_UPI000233AEF8UniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233AEF8 related cluster n=1 Tax=unknown RepID=UPI000233AEF8 SoyBaseE_val: 8.00E-160ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g31873 not represented in the dataset

Glyma16g31873 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma09g25940 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g194100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g31873.1   sequence type=CDS   gene model=Glyma16g31873   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTTGCAACTATGGGAGACACTGAAGGAGGCCATAGAAGCGTACACGGGGCTCTCTCCGAACACCTTCTTCACCCTGCTGGCCCTCATCCTGGCCCTCTACTACGTCGTTTCGGGCCTCTTCCCCTCCTCCTCCGACCACCGCCACAACACCGCCTCGCGTGACTTCGAGCCTCAGATGGAGCCTCTGCGACCCCCTGTTCAAATCGGCGAGGTCACCGAGGAAGAACTCAAGGCCTACGACGGCTCCGATCCCGAGAAGCCTCTCCTCATGGCCATCAAGGGCCAGATCTATGATGTTTCCCAGAGCAGAATGTTTTATGGACCTGGTGGACCCTATGCTCTATTTGCTGGCAAGGATGCTAGCAGAGCTTTAGCAAAGATGTCTTTTGAAGAGAAAGATCTAACTGGAGATATCTCTGGTCTTGGCCCATTTGAGGTTGAGGCCTTGCAAGACTGGGAATACAAGTTTATGGGCAAGTATGTAAAAGTTGGAACTGTCAAAAAGACCGTTCCAGTAACTGAACCAGAATCCACTGGCGAAGCAGCAGAATCTAATGTCCATGATGCTGAATCTTCAAAGCCTACTGAAGATGATGGCCCATCAGAATCAGCAGCTGCTAAAAATGATGGAACCCCTTCAAAGATTGACGCAGATAAAGAGTAA

>Glyma16g31873.1   sequence type=predicted peptide   gene model=Glyma16g31873   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MALQLWETLKEAIEAYTGLSPNTFFTLLALILALYYVVSGLFPSSSDHRHNTASRDFEPQMEPLRPPVQIGEVTEEELKAYDGSDPEKPLLMAIKGQIYDVSQSRMFYGPGGPYALFAGKDASRALAKMSFEEKDLTGDISGLGPFEVEALQDWEYKFMGKYVKVGTVKKTVPVTEPESTGEAAESNVHDAESSKPTEDDGPSESAAAKNDGTPSKIDADKE*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo