Glyma16g26110 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma16g26110

Feature Type:	gene_model
Chromosome:	Gm16
Start:	30299355
stop:	30305628
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma16g26110

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G07950	AT	Annotation by Michelle Graham. TAIR10: rhomboid protein-related \| chr3:2531982-2534277 FORWARD LENGTH=304	SoyBase	E_val: 6.00E-150	ISS
GO:0006816	GO-bp	Annotation by Michelle Graham. GO Biological Process: calcium ion transport	SoyBase	N/A	ISS
GO:0007030	GO-bp	Annotation by Michelle Graham. GO Biological Process: Golgi organization	SoyBase	N/A	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009651	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to salt stress	SoyBase	N/A	ISS
GO:0005794	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: Golgi apparatus	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
KOG2890	KOG	Predicted membrane protein	JGI		ISS
PTHR13377	Panther	PLACENTAL PROTEIN 6	JGI		ISS
PF08551	PFAM	Eukaryotic integral membrane protein (DUF1751)	JGI		ISS
UniRef100_G7I9J5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Transmembrane protein n=1 Tax=Medicago truncatula RepID=G7I9J5_MEDTR	SoyBase	E_val: 3.00E-164	ISS
UniRef100_I1MNM2	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MNM2_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma16g26110

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma16g26110

Paralog	Evidence	Comments
Glyma02g07160	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma16g26110 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.16g145700	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma16g26110

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma16g26110

Limit To All Plant Sequences

>Glyma16g26110.1   sequence type=CDS   gene model=Glyma16g26110   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCACGCCAGCGCTTTCAGGGGGCACGGGCCTCTTCTCTGGGTTCACTCGGTTATGCAAGGGCCTTGCGGTGGTGCTTGTTTGCGGTCACATTGCGGTTCAGTTTTTCCCTTCAGCTGTTAACTACCTTGCTCTTATTCCCGCCAGGACAATCCCATTTGCCTGGAATCTCATCACAGCTGGTTATGTTGAACAATCTATATATGGGGTAGTGGTCAGCACATTAAGTCTCCTGTTTATTGGGAAGCTGCTTGAACCAATATGGGGCTCCAGGGAATTCTTTAAATTCATCTTTGTGGTTAATCTTCTAACTTCAGTATGTTTATTCATCACTGCTATTGCTTTATACTACATTACAAGGCTGGAGACTTACCTTTACATGCCACTTTCTGGATTTCATGGAGTTGTATCTGGTTTCTTGGTTGGCGTCAAGCAAATTATACCAGATCAAGAGCTTCCTTTCATTAAGATAAAAACAAAGTGGTTGCCATCTATCACTGTATTGCTTTCCATTGCTATTAGCTTCTGGACGCTAGAGGCTACAGCATATCTTCCAACCATTATATCTGGCACGTATATAAGCTGGATTTATCTTAGATACTGGCAGAGGAAACCAGAAACTAAACATAGAGGTGACCTGAGTGAAGATTTTGCTTTCTCCACATTTTTTCCAGAATTTTTAAGACCGGTCATTGACCCTATCGCTTCAATATTTCATCGAATGCTCTGTGGAAGATATGATGCTTCTAATGATGATGGCTACAGTCTGGAAAATGAGCCTTTACCAGGTTCAGACTCAATTGAGGCATCCAGGAGAAGAGAAAGAGGTGCTCGAGCACTGGAAGAACGATTGGCTGCAGAGAGGTTGGCTGCTGCACGACGTGAGTTGCAAAGAGAGGCTGAGGAAAATGTGTAA

Predicted protein sequences of Glyma16g26110

Limit To All Plant Sequences

>Glyma16g26110.1   sequence type=predicted peptide   gene model=Glyma16g26110   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSTPALSGGTGLFSGFTRLCKGLAVVLVCGHIAVQFFPSAVNYLALIPARTIPFAWNLITAGYVEQSIYGVVVSTLSLLFIGKLLEPIWGSREFFKFIFVVNLLTSVCLFITAIALYYITRLETYLYMPLSGFHGVVSGFLVGVKQIIPDQELPFIKIKTKWLPSITVLLSIAISFWTLEATAYLPTIISGTYISWIYLRYWQRKPETKHRGDLSEDFAFSTFFPEFLRPVIDPIASIFHRMLCGRYDASNDDGYSLENEPLPGSDSIEASRRRERGARALEERLAAERLAAARRELQREAEENV*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain