Glyma16g24800 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma16g24800

Feature Type:	gene_model
Chromosome:	Gm16
Start:	28754615
stop:	28757220
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma16g24800

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT3G11480	AT	Annotation by Michelle Graham. TAIR10: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein \| chr3:3614544-3617137 FORWARD LENGTH=379	SoyBase	E_val: 1.00E-98	ISS
GO:0006952	GO-bp	Annotation by Michelle Graham. GO Biological Process: defense response	SoyBase	N/A	ISS
GO:0009611	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to wounding	SoyBase	N/A	ISS
GO:0009620	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to fungus	SoyBase	N/A	ISS
GO:0009695	GO-bp	Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process	SoyBase	N/A	ISS
GO:0009753	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus	SoyBase	N/A	ISS
GO:0051707	GO-bp	Annotation by Michelle Graham. GO Biological Process: response to other organism	SoyBase	N/A	ISS
GO:0005634	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: nucleus	SoyBase	N/A	ISS
GO:0008168	GO-mf	Annotation by Michelle Graham. GO Molecular Function: methyltransferase activity	SoyBase	N/A	ISS
GO:0008757	GO-mf	Annotation by Michelle Graham. GO Molecular Function: S-adenosylmethionine-dependent methyltransferase activity	SoyBase	N/A	ISS
GO:0052624	GO-mf	Annotation by Michelle Graham. GO Molecular Function: 2-phytyl-1,4-naphthoquinone methyltransferase activity	SoyBase	N/A	ISS
GO:0080150	GO-mf	Annotation by Michelle Graham. GO Molecular Function: S-adenosyl-L-methionine:benzoic acid carboxyl methyl transferase activity	SoyBase	N/A	ISS
PF03492	PFAM	SAM dependent carboxyl methyltransferase	JGI		ISS
UniRef100_B5A7G5	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Salicylic acid methyl transferase-like protein n=1 Tax=Glycine max RepID=B5A7G5_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_I1MNB4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MNB4_SOYBN	SoyBase	E_val: 0	ISS

Expression Patterns of Glyma16g24800

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma16g24800

Paralog	Evidence	Comments
Glyma02g06070	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma16g24800 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.16g134400	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma16g24800

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma16g24800

Limit To All Plant Sequences

>Glyma16g24800.1   sequence type=CDS   gene model=Glyma16g24800   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGGTAGCACATGTGCTACACATGAACGGTGGCGTTGGACACGCAAGCTATGCAAACAACTCCCTTGTTCAGCAAAAGGTGATTTGTTTGACAAAGCCCATAAGAGAGGAAGCCATAACAAGCCTCTATTGCAACACCGTCCCCAGAAGCTTGGCGGTTGCAGATTTGGGTTGCTCTTCTGGACCAAACACTTTGCTTGTTGTGTCTGAATTCATCAAAATTGTGGAGAAGCTTTGCCGGGAGCTAAACCATAAATCTCCAGAATACAAGGTCTTTCTGAATGATCTTCCTGGGAATGACTTCAACAACATCTTCAAGTCCCTTGATAGCTTCAAAGAGAAGTTGCGTGATGAAATGGAAAGTAGGATTGGTCCATGCTACTTCTATGGGGTTCCTGGTTCTTTCTATGGCAGGGTTTTCCCAAATCAAAGTCTTCATTTTGTCCATTCCTCTTATAGCCTTCAATGGCTATCTAAGGTTCCTGAGGGTGTAGACAACAACAGGGGCAATGTTTACATTGGCAGTACAAGCCCGACAAATGTTGCGAGAGCTTACTACGAGCAATTTCAAAGAGATTTCTCTCTTTTTCTCAAGTGTCGTGCAGAGGAATTAGTTAAAGGAGGTTGTATGGTTCTAACATTTTTGGGAAGAAGAAGCGATGATCCCTCTAGCAAAGATGGTGGCTACATTTGGGAGCTTATGGCTACTGCTCTTAATGATATGGTCTTGCAGGGAATCATAAAAGAAGAGCAATTAGATACTTTTAACATTCCTCAATACACTCCATCTCCATCTGAAGTGAAATTGGAAGTTCTTAAAGAAGGTTCATTTGCCATCAATCGTCTAGAAGTGTCTGAAGTGAATTGGGATGCTTTTGATGACTGGAACGCTCTTGAATTTGAATCTGAAAGGGCTGATTCACTTAGTGATGGCGGATACAATGTGGCACAGTGCATGAGGGCTGTGGCAGAACCAATGCTTGTTAGCCACTTTGGTGAAGCTATCATTGAAGAGGTTTTTAGCCGCTACCAACAAATTTTGGCTGATCGTATGTCTAAGGAGAAAACTAAGTTCACCAATGTCACCATATTATTGACTAAAAAGGCATAA

Predicted protein sequences of Glyma16g24800

Limit To All Plant Sequences

>Glyma16g24800.1   sequence type=predicted peptide   gene model=Glyma16g24800   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKVAHVLHMNGGVGHASYANNSLVQQKVICLTKPIREEAITSLYCNTVPRSLAVADLGCSSGPNTLLVVSEFIKIVEKLCRELNHKSPEYKVFLNDLPGNDFNNIFKSLDSFKEKLRDEMESRIGPCYFYGVPGSFYGRVFPNQSLHFVHSSYSLQWLSKVPEGVDNNRGNVYIGSTSPTNVARAYYEQFQRDFSLFLKCRAEELVKGGCMVLTFLGRRSDDPSSKDGGYIWELMATALNDMVLQGIIKEEQLDTFNIPQYTPSPSEVKLEVLKEGSFAINRLEVSEVNWDAFDDWNALEFESERADSLSDGGYNVAQCMRAVAEPMLVSHFGEAIIEEVFSRYQQILADRMSKEKTKFTNVTILLTKKA*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain