SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma16g24800

Feature Type:gene_model
Chromosome:Gm16
Start:28754615
stop:28757220
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G11480AT Annotation by Michelle Graham. TAIR10: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein | chr3:3614544-3617137 FORWARD LENGTH=379 SoyBaseE_val: 1.00E-98ISS
GO:0006952GO-bp Annotation by Michelle Graham. GO Biological Process: defense response SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009620GO-bp Annotation by Michelle Graham. GO Biological Process: response to fungus SoyBaseN/AISS
GO:0009695GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid biosynthetic process SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0051707GO-bp Annotation by Michelle Graham. GO Biological Process: response to other organism SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0008168GO-mf Annotation by Michelle Graham. GO Molecular Function: methyltransferase activity SoyBaseN/AISS
GO:0008757GO-mf Annotation by Michelle Graham. GO Molecular Function: S-adenosylmethionine-dependent methyltransferase activity SoyBaseN/AISS
GO:0052624GO-mf Annotation by Michelle Graham. GO Molecular Function: 2-phytyl-1,4-naphthoquinone methyltransferase activity SoyBaseN/AISS
GO:0080150GO-mf Annotation by Michelle Graham. GO Molecular Function: S-adenosyl-L-methionine:benzoic acid carboxyl methyl transferase activity SoyBaseN/AISS
PF03492PFAM SAM dependent carboxyl methyltransferase JGI ISS
UniRef100_B5A7G5UniRef Annotation by Michelle Graham. Most informative UniRef hit: Salicylic acid methyl transferase-like protein n=1 Tax=Glycine max RepID=B5A7G5_SOYBN SoyBaseE_val: 0ISS
UniRef100_I1MNB4UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MNB4_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma02g06070 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g134400 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g24800.1   sequence type=CDS   gene model=Glyma16g24800   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAAGGTAGCACATGTGCTACACATGAACGGTGGCGTTGGACACGCAAGCTATGCAAACAACTCCCTTGTTCAGCAAAAGGTGATTTGTTTGACAAAGCCCATAAGAGAGGAAGCCATAACAAGCCTCTATTGCAACACCGTCCCCAGAAGCTTGGCGGTTGCAGATTTGGGTTGCTCTTCTGGACCAAACACTTTGCTTGTTGTGTCTGAATTCATCAAAATTGTGGAGAAGCTTTGCCGGGAGCTAAACCATAAATCTCCAGAATACAAGGTCTTTCTGAATGATCTTCCTGGGAATGACTTCAACAACATCTTCAAGTCCCTTGATAGCTTCAAAGAGAAGTTGCGTGATGAAATGGAAAGTAGGATTGGTCCATGCTACTTCTATGGGGTTCCTGGTTCTTTCTATGGCAGGGTTTTCCCAAATCAAAGTCTTCATTTTGTCCATTCCTCTTATAGCCTTCAATGGCTATCTAAGGTTCCTGAGGGTGTAGACAACAACAGGGGCAATGTTTACATTGGCAGTACAAGCCCGACAAATGTTGCGAGAGCTTACTACGAGCAATTTCAAAGAGATTTCTCTCTTTTTCTCAAGTGTCGTGCAGAGGAATTAGTTAAAGGAGGTTGTATGGTTCTAACATTTTTGGGAAGAAGAAGCGATGATCCCTCTAGCAAAGATGGTGGCTACATTTGGGAGCTTATGGCTACTGCTCTTAATGATATGGTCTTGCAGGGAATCATAAAAGAAGAGCAATTAGATACTTTTAACATTCCTCAATACACTCCATCTCCATCTGAAGTGAAATTGGAAGTTCTTAAAGAAGGTTCATTTGCCATCAATCGTCTAGAAGTGTCTGAAGTGAATTGGGATGCTTTTGATGACTGGAACGCTCTTGAATTTGAATCTGAAAGGGCTGATTCACTTAGTGATGGCGGATACAATGTGGCACAGTGCATGAGGGCTGTGGCAGAACCAATGCTTGTTAGCCACTTTGGTGAAGCTATCATTGAAGAGGTTTTTAGCCGCTACCAACAAATTTTGGCTGATCGTATGTCTAAGGAGAAAACTAAGTTCACCAATGTCACCATATTATTGACTAAAAAGGCATAA

>Glyma16g24800.1   sequence type=predicted peptide   gene model=Glyma16g24800   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MKVAHVLHMNGGVGHASYANNSLVQQKVICLTKPIREEAITSLYCNTVPRSLAVADLGCSSGPNTLLVVSEFIKIVEKLCRELNHKSPEYKVFLNDLPGNDFNNIFKSLDSFKEKLRDEMESRIGPCYFYGVPGSFYGRVFPNQSLHFVHSSYSLQWLSKVPEGVDNNRGNVYIGSTSPTNVARAYYEQFQRDFSLFLKCRAEELVKGGCMVLTFLGRRSDDPSSKDGGYIWELMATALNDMVLQGIIKEEQLDTFNIPQYTPSPSEVKLEVLKEGSFAINRLEVSEVNWDAFDDWNALEFESERADSLSDGGYNVAQCMRAVAEPMLVSHFGEAIIEEVFSRYQQILADRMSKEKTKFTNVTILLTKKA*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo