SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g24760): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g24760): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g24760

Feature Type:gene_model
Chromosome:Gm16
Start:28740768
stop:28742726
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G23460AT Annotation by Michelle Graham. TAIR10: extra-large G-protein 1 | chr2:9995699-9998945 FORWARD LENGTH=888 SoyBaseE_val: 6.00E-18ISS
GO:0006184GO-bp Annotation by Michelle Graham. GO Biological Process: GTP catabolic process SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0007186GO-bp Annotation by Michelle Graham. GO Biological Process: G-protein coupled receptor signaling pathway SoyBaseN/AISS
GO:0007188GO-bp Annotation by Michelle Graham. GO Biological Process: adenylate cyclase-modulating G-protein coupled receptor signaling pathway SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009744GO-bp Annotation by Michelle Graham. GO Biological Process: response to sucrose stimulus SoyBaseN/AISS
GO:0009749GO-bp Annotation by Michelle Graham. GO Biological Process: response to glucose stimulus SoyBaseN/AISS
GO:0009750GO-bp Annotation by Michelle Graham. GO Biological Process: response to fructose stimulus SoyBaseN/AISS
GO:0010555GO-bp Annotation by Michelle Graham. GO Biological Process: response to mannitol stimulus SoyBaseN/AISS
GO:2000067GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of root morphogenesis SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005834GO-cc Annotation by Michelle Graham. GO Cellular Compartment: heterotrimeric G-protein complex SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0031234GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extrinsic to internal side of plasma membrane SoyBaseN/AISS
GO:0001664GO-mf Annotation by Michelle Graham. GO Molecular Function: G-protein coupled receptor binding SoyBaseN/AISS
GO:0003924GO-mf Annotation by Michelle Graham. GO Molecular Function: GTPase activity SoyBaseN/AISS
GO:0004871GO-mf Annotation by Michelle Graham. GO Molecular Function: signal transducer activity SoyBaseN/AISS
GO:0019001GO-mf Annotation by Michelle Graham. GO Molecular Function: guanyl nucleotide binding SoyBaseN/AISS
GO:0031683GO-mf Annotation by Michelle Graham. GO Molecular Function: G-protein beta/gamma-subunit complex binding SoyBaseN/AISS
UniRef100_G7K9F9UniRef Annotation by Michelle Graham. Most informative UniRef hit: Guanine nucleotide-binding protein alpha-2 subunit n=1 Tax=Medicago truncatula RepID=G7K9F9_MEDTR SoyBaseE_val: 2.00E-26ISS
UniRef100_UPI0002336ED6UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0002336ED6 related cluster n=1 Tax=unknown RepID=UPI0002336ED6 SoyBaseE_val: 9.00E-30ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g24760 not represented in the dataset

Glyma16g24760 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g134200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g24760.1   sequence type=CDS   gene model=Glyma16g24760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGACAACTCCAGCGATTTGTCCGATTTGGGGGGAAGTTCGAGAGTGCTGGAAACTAGAAGCTCCAATACCATTGAGTTTTGGGACAAGTAAAGGAGAAGTTCTGGCTTGTCAAGGGTTTTGGAAGATGGAAAAGAGATCCATGCTGAGTTTGGAGTATCCATCAACTCGGGTTTCTTCTCTCAAGGCTGAGGATATCGATGCCAAATGTCCCCATGTTATTACTTTCGATGTGGACACTTATGTGCTTCAATTGACAAAAAAGAAACTTACACTGCAAGTTTTTGGGCAGACTTGTATCAATGACCAATGCTATATTTACTGGCAAGGATGGGCAGACATATGGGGAAAGGCTGGAACGAAGCTTGTATGTTCTTTCCTATTCCTGTCAGTTCCTTCTAAATCTTCAAATTCTTTGGGAGAACAACCCTCCAGTCTGGCTAGCAGAACATTGCCTGACTACGTTGAGCATGGGATAGTTCAGAAGCTTCTCTTAGTTGGTTGCAGTGGATCTGGAACGAGCATTATTTTTAAACAGGTTACTGTAAATGTTAATTGGATGCACATTTATGTTACTCTCTTTTGTATAATTTGCCCAAATTACAACTTTATTTTATTGCAGATCAATACTGAGTCATCATTTCCCGTATCACTACTCATTATATACATAAAAATAAAAAGTGATCAATTATCCCAAAATTAA

>Glyma16g24760.1   sequence type=predicted peptide   gene model=Glyma16g24760   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MTTPAICPIWGEVRECWKLEAPIPLSFGTSKGEVLACQGFWKMEKRSMLSLEYPSTRVSSLKAEDIDAKCPHVITFDVDTYVLQLTKKKLTLQVFGQTCINDQCYIYWQGWADIWGKAGTKLVCSFLFLSVPSKSSNSLGEQPSSLASRTLPDYVEHGIVQKLLLVGCSGSGTSIIFKQVTVNVNWMHIYVTLFCIICPNYNFILLQINTESSFPVSLLIIYIKIKSDQLSQN*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo