SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g23763): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g23763): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g23763

Feature Type:gene_model
Chromosome:Gm16
Start:27636721
stop:27638103
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma16g23763
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G48360AT Annotation by Michelle Graham. TAIR10: zinc ion binding;nucleic acid binding;hydrolases, acting on acid anhydrides, in phosphorus-containing anhydrides | chr1:17868661-17872946 FORWARD LENGTH=891 SoyBaseE_val: 1.00E-32ISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003676GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleic acid binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0016788GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, acting on ester bonds SoyBaseN/AISS
GO:0016818GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, acting on acid anhydrides, in phosphorus-containing anhydrides SoyBaseN/AISS
PTHR15749Panther FAMILY NOT NAMED JGI ISS
PTHR15749:SF6Panther JGI ISS
UniRef100_G7KUQ4UniRef Annotation by Michelle Graham. Most informative UniRef hit: Coiled-coil domain-containing protein MTMR15 n=1 Tax=Medicago truncatula RepID=G7KUQ4_MEDTR SoyBaseE_val: 8.00E-42ISS
UniRef100_UPI000233B8FBUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233B8FB related cluster n=1 Tax=unknown RepID=UPI000233B8FB SoyBaseE_val: 4.00E-55ISS

Expression Patterns of Glyma16g23763
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g23763 not represented in the dataset
Glyma16g23763 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma16g23763 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g127800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma16g23763
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma16g23763
>Glyma16g23763.1   sequence type=CDS   gene model=Glyma16g23763   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTAGCCTCTCCTTCAGAGAACCGAACCAGATGCAGGAAGCGTAAGAGAGATTCGCCAATCAGCCGGCGCCACCAGAAGCACGAGGAGGAGGAGGACGATGACGATGAAAACCCAAATGCGGAGGAAGACCTCGCCGAACGAGACTACGATTCGGAGGACCAAACGCACCACAACCACCCTAATTCGCAACCTCATGTGGAGACGGAGGTCCTCTCCGACCACGGCGTTCAGATGTCGCAGTTCCCGCCAGTGATAAAGCACTCCGTGAATCGCCCTCACTCCTCCGTCACCACAATTGTTGCTCTCGAGCGTGCCCTCCATGGAATCGCCCTCACTAGATTTCAGAATGCTCCTTTAGATTTTGGTACTGATGACTTTTATATTGCAAGAAAGAGTAGCATAGAATCCCATCTGCAGCAAATTCGTGATGGCATGGCTGAGGAGTTTCTTATTAAGTCATGGGAAACACATATTGGAACAACATGTAGAGGAGTTAATTGGGGCTGCCATTCTTTAGATGAGCTTCGCGCTGATGTTTCTTGTGTTGGGGGCACTTGCTTGGCATCTCTCTGCAAACTTCTGGCTCAAGACTATCGGAGCTGA
Predicted protein sequences of Glyma16g23763
>Glyma16g23763.1   sequence type=predicted peptide   gene model=Glyma16g23763   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLASPSENRTRCRKRKRDSPISRRHQKHEEEEDDDDENPNAEEDLAERDYDSEDQTHHNHPNSQPHVETEVLSDHGVQMSQFPPVIKHSVNRPHSSVTTIVALERALHGIALTRFQNAPLDFGTDDFYIARKSSIESHLQQIRDGMAEEFLIKSWETHIGTTCRGVNWGCHSLDELRADVSCVGGTCLASLCKLLAQDYRS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo