SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma16g21904

Feature Type:gene_model
Chromosome:Gm16
Start:25230639
stop:25232171
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma16g21904
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
ATCG00120AT Annotation by Michelle Graham. TAIR10: ATP synthase subunit alpha | chrC:9938-11461 REVERSE LENGTH=507 SoyBaseE_val: 1.00E-106ISS
GO:0006091GO-bp Annotation by Michelle Graham. GO Biological Process: generation of precursor metabolites and energy SoyBaseN/AISS
GO:0006176GO-bp Annotation by Michelle Graham. GO Biological Process: dATP biosynthetic process from ADP SoyBaseN/AISS
GO:0006354GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent transcription, elongation SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009832GO-bp Annotation by Michelle Graham. GO Biological Process: plant-type cell wall biogenesis SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0015986GO-bp Annotation by Michelle Graham. GO Biological Process: ATP synthesis coupled proton transport SoyBaseN/AISS
GO:0015991GO-bp Annotation by Michelle Graham. GO Biological Process: ATP hydrolysis coupled proton transport SoyBaseN/AISS
GO:0016049GO-bp Annotation by Michelle Graham. GO Biological Process: cell growth SoyBaseN/AISS
GO:0019684GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light reaction SoyBaseN/AISS
GO:0030243GO-bp Annotation by Michelle Graham. GO Biological Process: cellulose metabolic process SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0046034GO-bp Annotation by Michelle Graham. GO Biological Process: ATP metabolic process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009544GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast ATP synthase complex SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0010287GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastoglobule SoyBaseN/AISS
GO:0010319GO-cc Annotation by Michelle Graham. GO Cellular Compartment: stromule SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0016469GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex SoyBaseN/AISS
GO:0031977GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid lumen SoyBaseN/AISS
GO:0033178GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting two-sector ATPase complex, catalytic domain SoyBaseN/AISS
GO:0045261GO-cc Annotation by Michelle Graham. GO Cellular Compartment: proton-transporting ATP synthase complex, catalytic core F(1) SoyBaseN/AISS
GO:0005524GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP binding SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0046933GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrogen ion transporting ATP synthase activity, rotational mechanism SoyBaseN/AISS
GO:0046961GO-mf Annotation by Michelle Graham. GO Molecular Function: proton-transporting ATPase activity, rotational mechanism SoyBaseN/AISS
KOG1353 KOG F0F1-type ATP synthase, alpha subunit JGI ISS
PTHR15184Panther ATP SYNTHASE JGI ISS
PTHR15184:SF25Panther JGI ISS
PF00006PFAM ATP synthase alpha/beta family, nucleotide-binding domain JGI ISS
PF00306PFAM ATP synthase alpha/beta chain, C terminal domain JGI ISS
PF02874PFAM ATP synthase alpha/beta family, beta-barrel domain JGI ISS
UniRef100_I1MMV1UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MMV1_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q9BBS3UniRef Annotation by Michelle Graham. Most informative UniRef hit: ATP synthase subunit alpha, chloroplastic n=1 Tax=Lotus japonicus RepID=ATPA_LOTJA SoyBaseE_val: 3.00E-113ISS

Expression Patterns of Glyma16g21904
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g21904 not represented in the dataset
Glyma16g21904 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma16g21904 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g115300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma16g21904
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma16g21904
>Glyma16g21904.1   sequence type=CDS   gene model=Glyma16g21904   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGTAACCATTCGTGCATATGAAATTAGTAAAATTATCTGTGAACGCATTGAGCAATATAATACTAAAGTAAAAATTGCAAATACAGGTATCGCACTTCAAGTAGACGACAGTATTGCTTGTATTTATGGTCTTGATGAAGTAATGGTGGGTGAATTAGTGGAATTTGAAGAGGGTACTATAAGCATTGCTTTGAATTTGGAATCCAAAAATGTTGGTGGAAGTTCAGTAAAAGCAACAAGAAGAATTGCTCACATACCTGTAAGTGAGGCTTATTTGGGTCTTGTTATAAATGCCTTGGCTAAACCAATTGATGGTCGAGGAGAAATTTCAGCTTCAGAATCTCAATTAATTGAATCTCCTGCTCCCGGTATTATTTCGAGACGTTCCATATATGAGCCTCTCCAAACAGGACTTAATCTTATTGATTCGATGATCCCCATAGGACGTGGCCAACGAGAACTAATTATTGGAGATAGACAAACAGTGGGATTTTTTTATTTACATTCACGTCTTTTGGAAAGAGCCGCTAAATTAAGTTCTCAGTTAGGCGAAGGAAGTATGACTACTTTACCAATAGTTGAAACTCAATCGGGAGATGTTTCAGCTTATACTCCTACTAATGTAATTTCCATTACAGATGGCCAAATATTCTTATATGCAGATCTATTCAATGCTAGAATCAGACCCGCTATTAATGTAGGTATTTCTGTTTCCAGAGTTGGATCGGTGGCTCAAATTAAAGCCATGAAAAAAGTAGCTGGTAAATTAAAATTGGAATTAGCACAATTCGCAGAATTAGAAGCTTTTGCCCAATCCGCTTCTGATCTCGATAAAGATACTCAAAATCAATTAGCAAAAGCTCCTCTTACCATGGAAGAACAAATAATAACTATTTATACCAAAACGAATGGTTATCTTGATTTATTAGAAAATAGACAGGTAAGGAAATTTCTTGTTGAGTTACGTGCTTACTTAAAGAAGAATAAACCTCAATTCAAAGAAATCATATCTTCTACCAAGATGTTTCCTAGGGAAGCAGAAGTCCTTTTGAAGGAAGCTATTCAAGAACAGATGGGCCTCTTTTTACTACAAGAACATGTGGGAAAAAATTGA
Predicted protein sequences of Glyma16g21904
>Glyma16g21904.1   sequence type=predicted peptide   gene model=Glyma16g21904   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MVTIRAYEISKIICERIEQYNTKVKIANTGIALQVDDSIACIYGLDEVMVGELVEFEEGTISIALNLESKNVGGSSVKATRRIAHIPVSEAYLGLVINALAKPIDGRGEISASESQLIESPAPGIISRRSIYEPLQTGLNLIDSMIPIGRGQRELIIGDRQTVGFFYLHSRLLERAAKLSSQLGEGSMTTLPIVETQSGDVSAYTPTNVISITDGQIFLYADLFNARIRPAINVGISVSRVGSVAQIKAMKKVAGKLKLELAQFAELEAFAQSASDLDKDTQNQLAKAPLTMEEQIITIYTKTNGYLDLLENRQVRKFLVELRAYLKKNKPQFKEIISSTKMFPREAEVLLKEAIQEQMGLFLLQEHVGKN*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo