SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Notice: fwrite(): Write of 157 bytes failed with errno=28 No space left on device in /var/www/html/include/SeqFeatClass.php on line 369

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g20030): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g20030): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g20030

Feature Type:gene_model
Chromosome:Gm16
Start:22599301
stop:22605953
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G20310AT Annotation by Michelle Graham. TAIR10: Peptidase M50 family protein | chr4:10961639-10963283 FORWARD LENGTH=393 SoyBaseE_val: 5.00E-51ISS
GO:0006508GO-bp Annotation by Michelle Graham. GO Biological Process: proteolysis SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0004222GO-mf Annotation by Michelle Graham. GO Molecular Function: metalloendopeptidase activity SoyBaseN/AISS
PTHR13325Panther PROTEASE M50 MEMBRANE-BOUND TRANSCRIPTION FACTOR SITE 2 PROTEASE JGI ISS
PF02163PFAM Peptidase family M50 JGI ISS
UniRef100_C6TIY7UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TIY7_SOYBN SoyBaseE_val: 3.00E-144ISS
UniRef100_G7L723UniRef Annotation by Michelle Graham. Most informative UniRef hit: Membrane-bound transcription factor site-2 protease n=1 Tax=Medicago truncatula RepID=G7L723_MEDTR SoyBaseE_val: 1.00E-74ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g20030 not represented in the dataset

Glyma16g20030 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g20030.1   sequence type=CDS   gene model=Glyma16g20030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAAGTCGAAGCTAGGCGAATCAGGAGGTTTGTGCCTCAGAGGCCCTCACACCGCACTATTCTCCCGCTTCACGCTTCTTCCTCCTCCCACAATGTTTCCAACACCATTTCCTGCTGGTATTGCGACTACAAAATCTGCTCGTTTAATAGACCTCTTTTCCACTTTGGTCGCCGATACGCCAGGTTTTTGAAAGTGTGGTTTTCGATTGGGGTTGGGTTTGCCCTCTCTGCTGTACTCGGAGTCACTTTGGTTCTCCTTTGGGAACTAGCCAGAACATTGCATCTCTGTGCCGGCAGCAATAAGCTTGGAAGCTTTGCTAGATCCTTGCTATTTGGCATCCCTCCTTCAGTCCCTGGTTTAAGTTTATCGCTTGCTGATACTGGGTATGCATGTGTTTCTACCATCATATCTGTCTTCATGCATGAATTGGGTCATGCAGTTGCTGCCACAAGTGAGGGAATACAAGTAGAGTACATTGCCGTCTTCATTGCGATTCTATTTCCTGGTGCTCTGGTTGCCTTCAATTATGAATTTTTGCAGACTTTGCCTCATTTGACTGCCCTGCGTGTGTATTCTGCTGGCATTTGGCACAATGCAGTTGTAAGTTGA

>Glyma16g20030.1   sequence type=predicted peptide   gene model=Glyma16g20030   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEVEARRIRRFVPQRPSHRTILPLHASSSSHNVSNTISCWYCDYKICSFNRPLFHFGRRYARFLKVWFSIGVGFALSAVLGVTLVLLWELARTLHLCAGSNKLGSFARSLLFGIPPSVPGLSLSLADTGYACVSTIISVFMHELGHAVAATSEGIQVEYIAVFIAILFPGALVAFNYEFLQTLPHLTALRVYSAGIWHNAVVS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo