SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research


Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g19240): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g19240): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g19240

Feature Type:gene_model
Chromosome:Gm16
Start:21200792
stop:21202423
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma16g19240
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G11210AT Annotation by Michelle Graham. TAIR10: SGNH hydrolase-type esterase superfamily protein | chr3:3511101-3512899 REVERSE LENGTH=256 SoyBaseE_val: 7.00E-96ISS
GO:0006629GO-bp Annotation by Michelle Graham. GO Biological Process: lipid metabolic process SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0048046GO-cc Annotation by Michelle Graham. GO Cellular Compartment: apoplast SoyBaseN/AISS
GO:0016787GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity SoyBaseN/AISS
GO:0016788GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, acting on ester bonds SoyBaseN/AISS
KOG3035 KOG Isoamyl acetate-hydrolyzing esterase JGI ISS
PTHR14209Panther ISOAMYL ESTERASE - RELATED JGI ISS
PF00657PFAM GDSL-like Lipase/Acylhydrolase JGI ISS
UniRef100_G7JP31UniRef Annotation by Michelle Graham. Most informative UniRef hit: GDSL esterase/lipase CPRD49 n=1 Tax=Medicago truncatula RepID=G7JP31_MEDTR SoyBaseE_val: 2.00E-104ISS
UniRef100_I1MMN9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=2 Tax=Glycine max RepID=I1MMN9_SOYBN SoyBaseE_val: 3.00E-157ISS

Expression Patterns of Glyma16g19240
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g19240 not represented in the dataset
Glyma16g19240 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma16g19240 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g099200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma16g19240
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma16g19240
>Glyma16g19240.1   sequence type=CDS   gene model=Glyma16g19240   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTCAATGACACGATACAGGTTGATATTGATTTGCGAGGATATGCTGGTTGGAATTCAAGGCATGCTGTGCAGGTTCTGGATAAAGTTTTTCCCAAGGATGCCCCTGTGCAACCTTCATTGGTTATTGTCTACTTTGGTGGTAATGATTCTTCTACTCCCCACTCATCTGGCCTAGGTCCTCATGTGCCTCTCCAAGAATACATTGAAAATTTGAGGAAGATCGTTGACCATCTCAAGAGCCTCTCAGAGAACACTCGCATTCTACTTCTCAGTACTCCTCCCATCAATGAAGCAACAATTACGCCAAACAGTGATGGGAAACCAACAAAGACAAATGAAGCTTGTCAAATATATTCAGAAGCATGTTTGGATGTGTGCCGGAAGATGAATATCGAGGCCATGGATTTGTGGTCTGCTATTCAGAAAAGAGATAACTGGCAAGATGTTTGCTTCATTGATGGAATTCACCTGTCATCTGAGGGAAGCAAGATAGTGTTGAAAGAGATACTGAATGTCCTCAAAGGTGCAGAATGGGAACCTAGTCTATATTGGAAATCAATGCCAAGTGAGTTTGATGAAGATTCACCATATGATCCAATTGCATCTGATGGAAAGTCAACTGTTAATCTTTCCAACTGGGTCTTCCCTGACAATGACAAATGGGACTAG
Predicted protein sequences of Glyma16g19240
>Glyma16g19240.1   sequence type=predicted peptide   gene model=Glyma16g19240   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLNDTIQVDIDLRGYAGWNSRHAVQVLDKVFPKDAPVQPSLVIVYFGGNDSSTPHSSGLGPHVPLQEYIENLRKIVDHLKSLSENTRILLLSTPPINEATITPNSDGKPTKTNEACQIYSEACLDVCRKMNIEAMDLWSAIQKRDNWQDVCFIDGIHLSSEGSKIVLKEILNVLKGAEWEPSLYWKSMPSEFDEDSPYDPIASDGKSTVNLSNWVFPDNDKWD*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo