|
A newer version of this gene model can be found here:
Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
---|---|---|---|---|---|
AT2G02100 | AT | Annotation by Michelle Graham. TAIR10: low-molecular-weight cysteine-rich 69 | chr2:528397-528885 FORWARD LENGTH=77 | SoyBase | E_val: 3.00E-28 | ISS |
GO:0006952 | GO-bp | Annotation by Michelle Graham. GO Biological Process: defense response | SoyBase | N/A | ISS |
GO:0005576 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: extracellular region | SoyBase | N/A | ISS |
GO:0005618 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cell wall | SoyBase | N/A | ISS |
GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
GO:0009505 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall | SoyBase | N/A | ISS |
GO:0030414 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: peptidase inhibitor activity | SoyBase | N/A | ISS |
PF00304 | PFAM | Gamma-thionin family | JGI | ISS | |
UniRef100_I1MMN0 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein (Fragment) n=1 Tax=Glycine max RepID=I1MMN0_SOYBN | SoyBase | E_val: 3.00E-49 | ISS |
UniRef100_Q39807 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Protease inhibitor n=1 Tax=Glycine max RepID=Q39807_SOYBN | SoyBase | E_val: 6.00E-48 | ISS |
Glyma16g18480 not represented in the dataset |
Glyma16g18480 not represented in the dataset |
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
Corresponding Name | Annotation Version | Evidence | Comments |
---|---|---|---|
Glyma.16g100400 | Wm82.a2.v1 | IGC | As supplied by JGI |
Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma16g18480.2 sequence type=CDS gene model=Glyma16g18480 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGTCTCGCTCCGTGCCTTTGGTTTCAACCATTTTTGTCTTGCTTCTGCTTCTGGTGGCCACTGAGATGATGGGGCCAACAATGGTGGCAGAAGCAAGAACTTGTGAGTCTCAGAGCCACCGTTTCAAGGGGCCATGTTTGAGTGACACCAACTGTGGCTCTGTTTGCCGAACCGAACGTTTCACTGGAGGACACTGCCGTGGCTTCCGTCGCAGATGCTTCTGCACCAAACATTGTTAA
>Glyma16g18480.2 sequence type=predicted peptide gene model=Glyma16g18480 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MSRSVPLVSTIFVLLLLLVATEMMGPTMVAEARTCESQSHRFKGPCLSDTNCGSVCRTERFTGGHCRGFRRRCFCTKHC*
Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||