|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT1G60960 | AT | Annotation by Michelle Graham. TAIR10: iron regulated transporter 3 | chr1:22445410-22447060 REVERSE LENGTH=425 | SoyBase | E_val: 1.00E-23 | ISS |
| GO:0006812 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cation transport | SoyBase | N/A | ISS |
| GO:0006826 | GO-bp | Annotation by Michelle Graham. GO Biological Process: iron ion transport | SoyBase | N/A | ISS |
| GO:0006829 | GO-bp | Annotation by Michelle Graham. GO Biological Process: zinc ion transport | SoyBase | N/A | ISS |
| GO:0006833 | GO-bp | Annotation by Michelle Graham. GO Biological Process: water transport | SoyBase | N/A | ISS |
| GO:0009624 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to nematode | SoyBase | N/A | ISS |
| GO:0010106 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cellular response to iron ion starvation | SoyBase | N/A | ISS |
| GO:0030001 | GO-bp | Annotation by Michelle Graham. GO Biological Process: metal ion transport | SoyBase | N/A | ISS |
| GO:0055085 | GO-bp | Annotation by Michelle Graham. GO Biological Process: transmembrane transport | SoyBase | N/A | ISS |
| GO:0071577 | GO-bp | Annotation by Michelle Graham. GO Biological Process: zinc ion transmembrane transport | SoyBase | N/A | ISS |
| GO:0005774 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane | SoyBase | N/A | ISS |
| GO:0005886 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane | SoyBase | N/A | ISS |
| GO:0009507 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: chloroplast | SoyBase | N/A | ISS |
| GO:0016020 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: membrane | SoyBase | N/A | ISS |
| GO:0016021 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: integral to membrane | SoyBase | N/A | ISS |
| GO:0005381 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: iron ion transmembrane transporter activity | SoyBase | N/A | ISS |
| GO:0005385 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: zinc ion transmembrane transporter activity | SoyBase | N/A | ISS |
| GO:0008324 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: cation transmembrane transporter activity | SoyBase | N/A | ISS |
| GO:0046873 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: metal ion transmembrane transporter activity | SoyBase | N/A | ISS |
| UniRef100_G7J7M9 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Cytochrome c oxidase subunit n=1 Tax=Medicago truncatula RepID=G7J7M9_MEDTR | SoyBase | E_val: 3.00E-26 | ISS |
| UniRef100_UPI000233A7D9 | UniRef | Annotation by Michelle Graham. Best UniRef hit: UPI000233A7D9 related cluster n=1 Tax=unknown RepID=UPI000233A7D9 | SoyBase | E_val: 3.00E-32 | ISS |
|
Glyma16g06611 not represented in the dataset |
Glyma16g06611 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.16g060200 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma16g06611.1 sequence type=CDS gene model=Glyma16g06611 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGACGAACTCAAGTTGCGGAGGCGCAGAGTTGGAGCTATGCCGAGATGATTTGGCCGCATTTTTTCTCAAGTTCGTCGCCATCTTGCTCATCAAAAAACACCTCTGCACCGACGGCAACCTCTTTGTCGCCACCAAGGTCTTCGCCCTAGGCGTCATTCTTGCCACCGAGGCGCTCCAGCACCCGTGCTTGCCTTCATTCTCGTGGTCCACGTTTCCCTTCACGGGATTCTTCGCCATGCTAGAATCTGTTTCAGCCACGCTATTTAGAGAAGGAAAATGA
>Glyma16g06611.1 sequence type=predicted peptide gene model=Glyma16g06611 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MTNSSCGGAELELCRDDLAAFFLKFVAILLIKKHLCTDGNLFVATKVFALGVILATEALQHPCLPSFSWSTFPFTGFFAMLESVSATLFREGK*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||