SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma16g06333

Feature Type:gene_model
Chromosome:Gm16
Start:5737325
stop:5742143
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma16g06333
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G25220AT Annotation by Michelle Graham. TAIR10: anthranilate synthase beta subunit 1 | chr1:8837430-8839478 REVERSE LENGTH=276 SoyBaseE_val: 2.00E-137ISS
GO:0000162GO-bp Annotation by Michelle Graham. GO Biological Process: tryptophan biosynthetic process SoyBaseN/AISS
GO:0008152GO-bp Annotation by Michelle Graham. GO Biological Process: metabolic process SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009851GO-bp Annotation by Michelle Graham. GO Biological Process: auxin biosynthetic process SoyBaseN/AISS
GO:0010311GO-bp Annotation by Michelle Graham. GO Biological Process: lateral root formation SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0004049GO-mf Annotation by Michelle Graham. GO Molecular Function: anthranilate synthase activity SoyBaseN/AISS
KOG0026 KOG Anthranilate synthase, beta chain JGI ISS
PTHR11922Panther GMP SYNTHASE-RELATED JGI ISS
PTHR11922:SF7Panther SUBFAMILY NOT NAMED JGI ISS
PF00117PFAM Glutamine amidotransferase class-I JGI ISS
UniRef100_B9HJK0UniRef Annotation by Michelle Graham. Most informative UniRef hit: Anthranilate synthase, beta subunit, ASB2 (Fragment) n=1 Tax=Populus trichocarpa RepID=B9HJK0_POPTR SoyBaseE_val: 2.00E-136ISS
UniRef100_UPI00018CC812UniRef Annotation by Michelle Graham. Best UniRef hit: UPI00018CC812 related cluster n=1 Tax=unknown RepID=UPI00018CC812 SoyBaseE_val: 0ISS

Expression Patterns of Glyma16g06333
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g06333 not represented in the dataset
Glyma16g06333 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Gene model name correspondences to Glyma16g06333 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g058800 Wm82.a2.v1IGC As supplied by JGI

References for Glyma16g06333
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma16g06333
>Glyma16g06333.1   sequence type=CDS   gene model=Glyma16g06333   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTGCCACATTCTTCTCTCACTTGTCGCTTCTTCAATCCAACAACAACCCTTCTCTCTCTCACACACCCTCTCGCTTCCCTCATTCTCTCACCAACCGTGTCAAACCCTCCCTCGGTGTGGTATCTGTGGCCAAAAGGGTAAGTGGAGTGGTGCCAAAGGCCAATTTGAATGCCTTGGAGGCCAATTCGGGTTTCCCCATTTCGGCTAAGAAGTCCAACAACAACCCCATTGTTGTTATTGACAACTATGACAGTTTCACCTATAATCTTTGCCAGTATATGGGGGAGTTAGGGTTTCACTTTGAGGTCTACCGCAATGATGAGTTGACAGTGGAGGAGTTAAGAAGGAAAAATCCCAGAGGAGTGCTGATATCACCTGGGCCAGGAGAACCTCAAGATTCAGGCATATCTTTGCAAACGGTTTTGGAACTTGGACCAACTGTGCCATTGTTTGGTGTGTGCATGGGTTTGCAATGCATTGGAGAGGCTTTTGGAGGGAAGATTGTTCGTTCTCCTCATGGTGTTATGCATGGAAAAAGCTCTATGGTTTACTATGATGAGAAAGGAGAAGATGGATTACTTGCTGGACTATCAAATCCTTTCTTGGCTGGTAGATATCACAGCCTTGTAATTGAAAAAGAGAGCTTTCCTCATGATGAACTTGAGGCAACAGCATGGACAGAAGATGGTCTTATAATGGCTGCTCGTCATAAGAAATATAAGCATCTACAGGGTGTTCAGTTTCATCCAGAGAGCATCATAACCCCAGAAGGCAAGACAATTGTCCGTAATTTTGTCAAGCTTATCGAGAAAAGGGAGGCTGGTGGCTCTTGA
Predicted protein sequences of Glyma16g06333
>Glyma16g06333.1   sequence type=predicted peptide   gene model=Glyma16g06333   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAATFFSHLSLLQSNNNPSLSHTPSRFPHSLTNRVKPSLGVVSVAKRVSGVVPKANLNALEANSGFPISAKKSNNNPIVVIDNYDSFTYNLCQYMGELGFHFEVYRNDELTVEELRRKNPRGVLISPGPGEPQDSGISLQTVLELGPTVPLFGVCMGLQCIGEAFGGKIVRSPHGVMHGKSSMVYYDEKGEDGLLAGLSNPFLAGRYHSLVIEKESFPHDELEATAWTEDGLIMAARHKKYKHLQGVQFHPESIITPEGKTIVRNFVKLIEKREAGGS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo