SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g05230): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g05230): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g05230

Feature Type:gene_model
Chromosome:Gm16
Start:4536783
stop:4539650
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G26720AT Annotation by Michelle Graham. TAIR10: Glycosyl hydrolase family 38 protein | chr3:9816707-9823056 FORWARD LENGTH=1019 SoyBaseE_val: 7.00E-49ISS
GO:0005975GO-bp Annotation by Michelle Graham. GO Biological Process: carbohydrate metabolic process SoyBaseN/AISS
GO:0006013GO-bp Annotation by Michelle Graham. GO Biological Process: mannose metabolic process SoyBaseN/AISS
GO:0007155GO-bp Annotation by Michelle Graham. GO Biological Process: cell adhesion SoyBaseN/AISS
GO:0010048GO-bp Annotation by Michelle Graham. GO Biological Process: vernalization response SoyBaseN/AISS
GO:0010090GO-bp Annotation by Michelle Graham. GO Biological Process: trichome morphogenesis SoyBaseN/AISS
GO:0045010GO-bp Annotation by Michelle Graham. GO Biological Process: actin nucleation SoyBaseN/AISS
GO:0048765GO-bp Annotation by Michelle Graham. GO Biological Process: root hair cell differentiation SoyBaseN/AISS
GO:0071555GO-bp Annotation by Michelle Graham. GO Biological Process: cell wall organization SoyBaseN/AISS
GO:0005576GO-cc Annotation by Michelle Graham. GO Cellular Compartment: extracellular region SoyBaseN/AISS
GO:0005773GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuole SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0009505GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plant-type cell wall SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003824GO-mf Annotation by Michelle Graham. GO Molecular Function: catalytic activity SoyBaseN/AISS
GO:0004553GO-mf Annotation by Michelle Graham. GO Molecular Function: hydrolase activity, hydrolyzing O-glycosyl compounds SoyBaseN/AISS
GO:0004559GO-mf Annotation by Michelle Graham. GO Molecular Function: alpha-mannosidase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
GO:0015923GO-mf Annotation by Michelle Graham. GO Molecular Function: mannosidase activity SoyBaseN/AISS
GO:0030246GO-mf Annotation by Michelle Graham. GO Molecular Function: carbohydrate binding SoyBaseN/AISS
PTHR11607Panther ALPHA-MANNOSIDASE JGI ISS
PTHR11607:SF3Panther LYSOSOMAL ALPHA-MANNOSIDASE (MANNOSIDASE ALPHA CLASS 2B MEMBER 1) JGI ISS
PF07748PFAM Glycosyl hydrolases family 38 C-terminal domain JGI ISS
UniRef100_G7KX96UniRef Annotation by Michelle Graham. Most informative UniRef hit: Lysosomal alpha-mannosidase n=1 Tax=Medicago truncatula RepID=G7KX96_MEDTR SoyBaseE_val: 5.00E-69ISS
UniRef100_I1N814UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=2 Tax=Glycine max RepID=I1N814_SOYBN SoyBaseE_val: 2.00E-79ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g05230 not represented in the dataset

Glyma16g05230 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Corresponding NameAnnotation VersionEvidenceComments

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g05230.1   sequence type=CDS   gene model=Glyma16g05230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCAAGAGCTGGTGACAATGGTGGTGTATATCATCAACTGGATGAATCTCAACGCTTATTTCTGGACGCGTGGACTACACAAATGCAACGTTTGTTGACCAAATCTTCCTTGTTTACTCTTAAACCTCTATCCCCTAGAGAATATTGCAAAGACAGTAAAATTTCTACTGATAATTCTAATGAGTTTACTATTTCTATTTCTCCTAGTGTTCAACCATTATTGCAGGAATTTAAAAATGTCCTTCATTGCCTAACAAGCCAACTTACAAAAGCAATCCCCAAGAGACTGATGATGCGAACCTTACGGGGCGGATCACTTGATACAGGCTGTAGAATTCAAGGAAAACTGTACCTTAGAATTGACCATAAAGGTGAAGGTGCTAATTGGTGTCGCACAGTTGGGCAGGAATTATATTCACCATTGCTGTTGGCCTTCACAGAACAGGAAGGAGACAATTGGTTGCATTTCATTCCATCAACATTTTCTGGCATAGATTCTTCCTACAGTTTACCTGACAACACTGCTCTTTTAACCCTCCAGGAATTTAAAAATGGAAAAGTACTCCTAAGATTGGCTCACCTTTATGAGATTGGAGAGGACAAAAATTACTCAGTAACGGCAAGTGTGGAATTGAAAAAATTGTTCCCTAACAAGAAGAAACCTGTTGATCCTATGAAGTTGGTGGTCGAACTTGCTCCAATGGAGATTCGAACATTCTTTATTGAATTTGATCCCCTCCAAACAGTTCCTGAAGCTGAAAATCATGTGGCAATGTAG

>Glyma16g05230.1   sequence type=predicted peptide   gene model=Glyma16g05230   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MARAGDNGGVYHQLDESQRLFLDAWTTQMQRLLTKSSLFTLKPLSPREYCKDSKISTDNSNEFTISISPSVQPLLQEFKNVLHCLTSQLTKAIPKRLMMRTLRGGSLDTGCRIQGKLYLRIDHKGEGANWCRTVGQELYSPLLLAFTEQEGDNWLHFIPSTFSGIDSSYSLPDNTALLTLQEFKNGKVLLRLAHLYEIGEDKNYSVTASVELKKLFPNKKKPVDPMKLVVELAPMEIRTFFIEFDPLQTVPEAENHVAM*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo