SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma16g05160

Feature Type:gene_model
Chromosome:Gm16
Start:4447529
stop:4449665
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma16g05160
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G19330AT Annotation by Michelle Graham. TAIR10: Protein of unknown function (DUF677) | chr3:6699423-6700772 FORWARD LENGTH=382 SoyBaseE_val: 1.00E-78ISS
GO:0008150GO-bp Annotation by Michelle Graham. GO Biological Process: biological process SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005886GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF05055PFAM Protein of unknown function (DUF677) JGI ISS
UniRef100_Q7X7I1UniRef Annotation by Michelle Graham. Most informative UniRef hit: OJ000315_02.21 protein n=2 Tax=Oryza sativa RepID=Q7X7I1_ORYSJ SoyBaseE_val: 7.00E-39ISS
UniRef100_UPI000233BEDEUniRef Annotation by Michelle Graham. Best UniRef hit: UPI000233BEDE related cluster n=1 Tax=unknown RepID=UPI000233BEDE SoyBaseE_val: 0ISS

Expression Patterns of Glyma16g05160
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma16g05160
ParalogEvidenceComments
Glyma19g27860 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma16g05160 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g047200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma16g05160
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma16g05160
>Glyma16g05160.2   sequence type=CDS   gene model=Glyma16g05160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGCTGGAATGCGTTTCTTTCAAATCATCGACTCCAACCTCCATCTCTTCTCCGCTTCCTCCTCCTTCTGAAGGGAACTCAACCGAGGAACTTGAAGAAGGAGAAGGCACTTCCGCCACAAGCCCTAACGTCTCACGCGAGTTCCACCGGGCCGTGGAGGCCCACTCCTACAACGAGATCCGGTCCATGGTCCAAGCCCCACCGCAGGTTCACCACATCGACGACGAAGACTCGCACCACCGCCACGTCCTCTCCCAGGTCCTCCAACCCGACTCACACAGCGTCCGCGAAGCCCTCGCCAAAGCGAAACCTAAGAGCAATCTCACTCGCCTCGTCTCCACCTACTTCGACCACAGCGAAACCGCCTCCGACTTCTGCCTCCGCCTCAGCCGCAGCGTTCACCGCGCCCGCTATCTCTACGCACCGCTCTCTGACCTCCTCTCCGTCCTCCCCGCCGACGCGCCTCTGCCGTCGCTCTCGCAACCGCAATGCAACCACGCCTACGACCTCTTCCTCCAATTCGACCGCGAGGAGAATCCTTTCGCGCTCTTCCGCCTCCACCGCCTCCGCGACAGCTTCTCCGACCTCAAGCGCGATATCCAGCGCGACCTCCGCAAGTGCCACTCGCGAATCCGCCTCTTCCGCCACGGCGCCGCGGGCTGCGCCCTCTGCTTCGTCGCCGCCGCTGCCGGCACCGTCCTTGTCGCCTCCATCGTCGCCGTGCATGCTGTAGTAGGGTTTAGCGCCCTCTCCGCGGCACCGTTTTGCGTCCCTCGGCAGAAGAAGAGGGAGCTTGCGAGGCTGAAGCAGCTTGAGGTTGTGGAGAATGGAACTCATGTGGTGAATGATATTAACACCATTGATAGTCTCGTTGATCGGCTTCAAACTGCGGTGGAAGGAGATAAGGCTTTTGTTAGATTTGCTTTGGAGAGGGGAAGGGAGAGACATCCGATTCAGGAAGTGCTTAAGCAACTTAGAAAGAACCAACCTGTTTTGGAACATTTGCTTGGGGATCTTGAGCAACATATATGCTTCTGCTTTTATAGTGTTAACAAGGCGAGATATGCGCTCCTCAAAGAGATATGCAGTCATCAAACTTCTTAG
Predicted protein sequences of Glyma16g05160
>Glyma16g05160.2   sequence type=predicted peptide   gene model=Glyma16g05160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MLECVSFKSSTPTSISSPLPPPSEGNSTEELEEGEGTSATSPNVSREFHRAVEAHSYNEIRSMVQAPPQVHHIDDEDSHHRHVLSQVLQPDSHSVREALAKAKPKSNLTRLVSTYFDHSETASDFCLRLSRSVHRARYLYAPLSDLLSVLPADAPLPSLSQPQCNHAYDLFLQFDREENPFALFRLHRLRDSFSDLKRDIQRDLRKCHSRIRLFRHGAAGCALCFVAAAAGTVLVASIVAVHAVVGFSALSAAPFCVPRQKKRELARLKQLEVVENGTHVVNDINTIDSLVDRLQTAVEGDKAFVRFALERGRERHPIQEVLKQLRKNQPVLEHLLGDLEQHICFCFYSVNKARYALLKEICSHQTS*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo