Report for Sequence Feature Glyma16g04540
Feature Type: gene_model
Chromosome: Gm16
Start: 3831070
stop: 3835060
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma16g04540
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT5G18140 AT
Annotation by Michelle Graham. TAIR10: Chaperone DnaJ-domain superfamily protein | chr5:5998235-5999699 FORWARD LENGTH=333
SoyBase E_val: 1.00E-87 ISS
GO:0006457 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein folding
SoyBase N/A ISS
GO:0009507 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: chloroplast
SoyBase N/A ISS
GO:0031072 GO-mf
Annotation by Michelle Graham. GO Molecular Function: heat shock protein binding
SoyBase N/A ISS
GO:0051082 GO-mf
Annotation by Michelle Graham. GO Molecular Function: unfolded protein binding
SoyBase N/A ISS
PTHR24076 Panther
FAMILY NOT NAMED
JGI ISS
PTHR24076:SF80 Panther
JGI ISS
PF00226 PFAM
DnaJ domain
JGI ISS
UniRef100_I1ML23 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1ML23_SOYBN
SoyBase E_val: 0 ISS
UniRef100_Q9FK56 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Chaperone DnaJ-domain containing protein n=1 Tax=Arabidopsis thaliana RepID=Q9FK56_ARATH
SoyBase E_val: 5.00E-85 ISS
Expression Patterns of Glyma16g04540
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma16g04540
Paralog Evidence Comments
Glyma19g28880 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma16g04540 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.16g041000 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma16g04540
Coding sequences of Glyma16g04540
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma16g04540.1 sequence type=CDS gene model=Glyma16g04540 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGGAATCGCACCTTCTGGTGGGACCCATATCCGTCGCATGCTATGGTGGCGCCGCCCACTTTCACTCCGCCGCACCCTCCACCTGGGCCAGTCCTCCTCGCCGGCGGTCGCCACTCGTCGTGGCCTCCTGGTCGTCCGCGGCCGTCAACGGCGGCCAGAACCACCACGCCATTCTTGGCGTCGCCCGCACTACCACCACCGTCCAAATCAAACGCTCTTATCAGCTCCTCGCCCGCAAGTATCATCCTGATGTTAGCAAGGATCCACAGGCTGCTGAATTATTCAAGAGCATCCATGATGCATATAAAGTACTATCTAATGAAGCAGCAAGAGTTCAGTATGACCAAGAACTTCAATTCGGTCACAAGCCTTACAGAGAAAAATGGAGTTACGGCCCTGAATTTGAAGATCAGGCTAGATTCTATAGGTGGGACCATCTGAGGAAAAAAAATGGATATGAAACAGATGAGGAAGAAGACGAAGTAGTAGATTTAGATGAAGAGAGGGGTTCTTTAGTTGAAGTGCTTAGATCAGCATTCGTGTCATTATTTTTGCTTCAGACACCTGGATCCCGCTTCTCACTCACATTCAGCAGTCTGACAGCATTGTTTGATAAGAAGTTAGACACCGGCTATAAAATGGGCTATATAATAACATGGATTTTGGGTGGGAGGGGTGGCATATTGCTAACACTGTGCTTGTTAGTTGCAAGTTGGGTTTGCGGGAAAACCGTTGTTGCATTTGTTGTGGTGGCCATATGGGTTGGCTCCTACCTCGCAAGGTATGCACCACTTCCCCAAGGTGCTTTATTGGCTCTTCTCTACATGTCCATTAAGCTACAATCTGACCTAATATAA
Predicted protein sequences of Glyma16g04540
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma16g04540.1 sequence type=predicted peptide gene model=Glyma16g04540 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MESHLLVGPISVACYGGAAHFHSAAPSTWASPPRRRSPLVVASWSSAAVNGGQNHHAILGVARTTTTVQIKRSYQLLARKYHPDVSKDPQAAELFKSIHDAYKVLSNEAARVQYDQELQFGHKPYREKWSYGPEFEDQARFYRWDHLRKKNGYETDEEEDEVVDLDEERGSLVEVLRSAFVSLFLLQTPGSRFSLTFSSLTALFDKKLDTGYKMGYIITWILGGRGGILLTLCLLVASWVCGKTVVAFVVVAIWVGSYLARYAPLPQGALLALLYMSIKLQSDLI*