SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g03820): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g03820): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g03820

Feature Type:gene_model
Chromosome:Gm16
Start:3189739
stop:3191501
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G00310AT Annotation by Michelle Graham. TAIR10: Putative membrane lipoprotein | chr4:133857-135235 FORWARD LENGTH=302 SoyBaseE_val: 2.00E-12ISS
GO:0009561GO-bp Annotation by Michelle Graham. GO Biological Process: megagametogenesis SoyBaseN/AISS
GO:0009640GO-bp Annotation by Michelle Graham. GO Biological Process: photomorphogenesis SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009793GO-bp Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy SoyBaseN/AISS
GO:0009845GO-bp Annotation by Michelle Graham. GO Biological Process: seed germination SoyBaseN/AISS
GO:0009909GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of flower development SoyBaseN/AISS
GO:0009933GO-bp Annotation by Michelle Graham. GO Biological Process: meristem structural organization SoyBaseN/AISS
GO:0010162GO-bp Annotation by Michelle Graham. GO Biological Process: seed dormancy process SoyBaseN/AISS
GO:0010182GO-bp Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway SoyBaseN/AISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0010564GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0019915GO-bp Annotation by Michelle Graham. GO Biological Process: lipid storage SoyBaseN/AISS
GO:0048366GO-bp Annotation by Michelle Graham. GO Biological Process: leaf development SoyBaseN/AISS
GO:0048825GO-bp Annotation by Michelle Graham. GO Biological Process: cotyledon development SoyBaseN/AISS
GO:0050826GO-bp Annotation by Michelle Graham. GO Biological Process: response to freezing SoyBaseN/AISS
GO:0051301GO-bp Annotation by Michelle Graham. GO Biological Process: cell division SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
PF08879PFAM WRC JGI ISS
UniRef100_I1MKU3UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MKU3_SOYBN SoyBaseE_val: 2.00E-152ISS
UniRef100_Q2HW76UniRef Annotation by Michelle Graham. Most informative UniRef hit: HMG-I and HMG-Y, DNA-binding n=1 Tax=Medicago truncatula RepID=Q2HW76_MEDTR SoyBaseE_val: 2.00E-27ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g03820 not represented in the dataset

Glyma16g03820 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma07g07410 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g034200 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g03820.2   sequence type=CDS   gene model=Glyma16g03820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGGATCCGCAAGAACGCCAAGCTTTCCCCTCTTCTGTTCTCCTCGTCCTTGTCGTCCTCGTCGTCTTCGTCCTGCGTACAAGGTGGTTCGGTTCCGTTGGAGTCGCACGTGTGCCAGTTGAACCAGTCCCCATGGGATGTGATCCCCTTTGACTCTGACTCGATCCAGTTCAAGCTCGACGACAACTTCACCGCGGGAAACAACAATGGCAGCGCTGTTAATTCCTTCGCCGCCGTCCAGAGCGTGGCGTCGATGATGGATGCAGGTAACAAAACTACTTGCCACTCGACGGTAATGGTTGACCTGGTGGCGCCGACAAATATTGACGCCACCGTAAACATGACCAATCCTTGTCAGTTTCACGATGACAAGGGTTGGCCATGTAAGAATGAAGCCGGACAAGGGCAGTCATTCTGCGAGCAGCATTTATCTTATTCTCTGCTCACTCCCCTCCACCACACCAGCAGCAAGAAATCGCAACCATCCGCGACCGGAACTCGCCGTGGCAAGACTCGGGGAGCGGCGGGGAAGAAGGCGGCAGCTGTGGCGGCGGCTGGGGCGAGTTCAAACCCGTATGAATTCTACTACTACTCCGGGTTCGGGCCCTCGTGGAGCAAACGAAGAGGTGATAGAAACGGTGGAGGAGAAGGGAGCAAGAATAATAGCGTTGGGGTTGAGAATTCGACAATGGTGGAGTCCGAGAATGTAGTGGGTGGTGGTGCTGACGATGTTGTCGATGATATTAATGGTAATGTGGCAAGTGTTGAGGTTGTTCCTTCGGTTTCGGAGATGGAACATGATGGGATAATCGACTATGTGGATGATGACGAAGAAGAAGAAGAAGAAGAGGTACTTGACGATAGCGGGAAGAAGAGAATGAGGAAGCCCGTGAAAGCAAGGTCGCTGAAATCGTTGATGTGA

>Glyma16g03820.2   sequence type=predicted peptide   gene model=Glyma16g03820   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MRIRKNAKLSPLLFSSSLSSSSSSSCVQGGSVPLESHVCQLNQSPWDVIPFDSDSIQFKLDDNFTAGNNNGSAVNSFAAVQSVASMMDAGNKTTCHSTVMVDLVAPTNIDATVNMTNPCQFHDDKGWPCKNEAGQGQSFCEQHLSYSLLTPLHHTSSKKSQPSATGTRRGKTRGAAGKKAAAVAAAGASSNPYEFYYYSGFGPSWSKRRGDRNGGGEGSKNNSVGVENSTMVESENVVGGGADDVVDDINGNVASVEVVPSVSEMEHDGIIDYVDDDEEEEEEEVLDDSGKKRMRKPVKARSLKSLM*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo