SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research



Report for Sequence Feature Glyma16g03670

Feature Type:gene_model
Chromosome:Gm16
Start:3084963
stop:3092540
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G01370AT Annotation by Michelle Graham. TAIR10: MAP kinase 4 | chr4:567219-568889 FORWARD LENGTH=376 SoyBaseE_val: 0ISS
GO:0000165GO-bp Annotation by Michelle Graham. GO Biological Process: MAPK cascade SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0006468GO-bp Annotation by Michelle Graham. GO Biological Process: protein phosphorylation SoyBaseN/AISS
GO:0006612GO-bp Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane SoyBaseN/AISS
GO:0006833GO-bp Annotation by Michelle Graham. GO Biological Process: water transport SoyBaseN/AISS
GO:0006970GO-bp Annotation by Michelle Graham. GO Biological Process: response to osmotic stress SoyBaseN/AISS
GO:0006972GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic response SoyBaseN/AISS
GO:0007030GO-bp Annotation by Michelle Graham. GO Biological Process: Golgi organization SoyBaseN/AISS
GO:0007112GO-bp Annotation by Michelle Graham. GO Biological Process: male meiosis cytokinesis SoyBaseN/AISS
GO:0007154GO-bp Annotation by Michelle Graham. GO Biological Process: cell communication SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0009266GO-bp Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus SoyBaseN/AISS
GO:0009409GO-bp Annotation by Michelle Graham. GO Biological Process: response to cold SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009555GO-bp Annotation by Michelle Graham. GO Biological Process: pollen development SoyBaseN/AISS
GO:0009595GO-bp Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009617GO-bp Annotation by Michelle Graham. GO Biological Process: response to bacterium SoyBaseN/AISS
GO:0009620GO-bp Annotation by Michelle Graham. GO Biological Process: response to fungus SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009697GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009861GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid and ethylene-dependent systemic resistance SoyBaseN/AISS
GO:0009862GO-bp Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009863GO-bp Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway SoyBaseN/AISS
GO:0009867GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0009868GO-bp Annotation by Michelle Graham. GO Biological Process: jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway SoyBaseN/AISS
GO:0010200GO-bp Annotation by Michelle Graham. GO Biological Process: response to chitin SoyBaseN/AISS
GO:0010310GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process SoyBaseN/AISS
GO:0010363GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response SoyBaseN/AISS
GO:0010374GO-bp Annotation by Michelle Graham. GO Biological Process: stomatal complex development SoyBaseN/AISS
GO:0016310GO-bp Annotation by Michelle Graham. GO Biological Process: phosphorylation SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0031348GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0035556GO-bp Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0042539GO-bp Annotation by Michelle Graham. GO Biological Process: hypotonic salinity response SoyBaseN/AISS
GO:0042742GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to bacterium SoyBaseN/AISS
GO:0043069GO-bp Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death SoyBaseN/AISS
GO:0043622GO-bp Annotation by Michelle Graham. GO Biological Process: cortical microtubule organization SoyBaseN/AISS
GO:0043900GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process SoyBaseN/AISS
GO:0045088GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0048481GO-bp Annotation by Michelle Graham. GO Biological Process: ovule development SoyBaseN/AISS
GO:0050832GO-bp Annotation by Michelle Graham. GO Biological Process: defense response to fungus SoyBaseN/AISS
GO:0051707GO-bp Annotation by Michelle Graham. GO Biological Process: response to other organism SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005737GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0004672GO-mf Annotation by Michelle Graham. GO Molecular Function: protein kinase activity SoyBaseN/AISS
GO:0004707GO-mf Annotation by Michelle Graham. GO Molecular Function: MAP kinase activity SoyBaseN/AISS
GO:0005515GO-mf Annotation by Michelle Graham. GO Molecular Function: protein binding SoyBaseN/AISS
GO:0016301GO-mf Annotation by Michelle Graham. GO Molecular Function: kinase activity SoyBaseN/AISS
KOG0660 KOG Mitogen-activated protein kinase JGI ISS
PTHR24055Panther MITOGEN-ACTIVATED PROTEIN KINASE JGI ISS
PTHR24055:SF69Panther JGI ISS
PF00069PFAM Protein kinase domain JGI ISS
UniRef100_G7KS68UniRef Annotation by Michelle Graham. Most informative UniRef hit: Mitogen-activated protein kinase n=1 Tax=Medicago truncatula RepID=G7KS68_MEDTR SoyBaseE_val: 0ISS
UniRef100_I1MKS9UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MKS9_SOYBN SoyBaseE_val: 0ISS

LocusGene SymbolProtein Name
MPK4a Mitogen-activated protein kinase kinase 4 gene a

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma07g07270 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g032900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g03670.1   sequence type=CDS   gene model=Glyma16g03670   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTGCTGTTGAGTCAGCTGAACACAACAACATCAGAGGAGTACCAACTCATGGTGGACGCTATGTTCAGTACAATATCTATGGCAATCTCTTCGAAGTTTCCAGAAAGTATGTCCCTCCTATTCGCCCTGTCGGTAGAGGTGCTTATGGTATTGTTTGCGCTGCTGTAAATGCAGAGACAGGCGAGGAAGTTGCCATTAAGAAGATTGGCAATGCATTCGACAACAGAATAGATGCCAAAAGGACCTTACGGGAAATTAAACTTCTTCGGCACATGGATCATGCAAATATTATGTCCATTAAAGATATTATACGTCCTCCACAGAAGGAAAACTTCAATGATGTGTACCTTGTTTCTGAGTTAATGGACACAGATCTGCATCAAATAATTCGTTCCAATCAGCAATTGACTGATGATCATTGTCGGTATTTTCTGTATCAATTGTTACGAGGGCTCAAATATGTACATTCAGCAAATGTTTTGCACCGAGATCTAAAGCCTAGTAATTTGCTATTGAATGCCAATTGTGACCTTAAGATTGCGGACTTTGGTCTTGCTAGAACCACATCTGAAACTGACTTTATGACTGAGTATGTGGTCACTAGATGGTACCGAGCTCCCGAATTGCTTCTTAATTGTTCAGAATATACAGCAGCCATTGATATATGGTCTGTTGGTTGCATACTTGGTGAAATCATAACAAGACAACCGCTCTTTCCTGGCAAAGATTATGTTCATCAGCTGAGACTTATCACAGAGCTGATAGGTTCGCCAGATGATGCCAGCCTTGGATTTCTACGAAGTGATAATGCTCGTAGATACGTAAAACAGCTTCCGCAGTATCCAAAACAAAACTTTTCTGCTAGATTTCCCACCATGTCTCCTGGTGCGGTTGACTTGCTAGAGAAGATGCTCATCTTTGATCCAAACAGGCGTATTACAGTTGACGAGGCGTTGAGCCACCCATACATGTCACCTCTCCATGACATCAATGAGGAACCTGTTTGCACCAGACCTTTCAGTTTTGACTTTGAGCAACCATCATTCACTGAAGAAGACATCAAGGAACTCATCTGGAGAGAATCTGTGAAGTTCAATCCTGTTCCACCAGTCTACTGA

>Glyma16g03670.1   sequence type=predicted peptide   gene model=Glyma16g03670   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSAVESAEHNNIRGVPTHGGRYVQYNIYGNLFEVSRKYVPPIRPVGRGAYGIVCAAVNAETGEEVAIKKIGNAFDNRIDAKRTLREIKLLRHMDHANIMSIKDIIRPPQKENFNDVYLVSELMDTDLHQIIRSNQQLTDDHCRYFLYQLLRGLKYVHSANVLHRDLKPSNLLLNANCDLKIADFGLARTTSETDFMTEYVVTRWYRAPELLLNCSEYTAAIDIWSVGCILGEIITRQPLFPGKDYVHQLRLITELIGSPDDASLGFLRSDNARRYVKQLPQYPKQNFSARFPTMSPGAVDLLEKMLIFDPNRRITVDEALSHPYMSPLHDINEEPVCTRPFSFDFEQPSFTEEDIKELIWRESVKFNPVPPVY*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo