Warning :  Undefined variable $sxsome in 
/var/www/html/include/SeqFeatClass.php  on line 
665 
Warning :  Undefined variable $sstart in 
/var/www/html/include/SeqFeatClass.php  on line 
665 
Warning :  Undefined variable $send in 
/var/www/html/include/SeqFeatClass.php  on line 
665 
Warning :  get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in 
/var/www/html/include/SeqFeatClass.php  on line 
1018 
Warning :  get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g03670): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in 
/var/www/html/include/SeqFeatClass.php  on line 
1018 
Warning :  Trying to access array offset on false in 
/var/www/html/include/SeqFeatClass.php  on line 
1019 
Warning :  get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in 
/var/www/html/include/SeqFeatClass.php  on line 
1020 
Warning :  get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g03670): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in 
/var/www/html/include/SeqFeatClass.php  on line 
1020 
Warning :  Trying to access array offset on false in 
/var/www/html/include/SeqFeatClass.php  on line 
1021 
Deprecated :  preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in 
/var/www/html/include/SeqFeatClass.php  on line 
1025 
Deprecated :  preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in 
/var/www/html/include/SeqFeatClass.php  on line 
1031 
	
	
	
Report for Sequence Feature Glyma16g03670 
      
      
    
      Feature Type: gene_model 
     
    
      Chromosome: Gm16   
    
      Start: 3084963 
     
    
      stop: 3092540 
     
    
      Source: JGI 
     
    
      Version: Wm82.a1.v1.1 
     
    
      High confidence: yes 
     
 
A newer version of this gene model can be found here: 
Annotations for Glyma16g03670
      
    Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code 
      AT4G01370 AT 
Annotation by Michelle Graham. TAIR10: MAP kinase 4 | chr4:567219-568889 FORWARD LENGTH=376 
SoyBase E_val: 0 ISS   
    
      GO:0000165 GO-bp 
Annotation by Michelle Graham. GO Biological Process: MAPK cascade 
SoyBase N/A ISS   
    
      GO:0006096 GO-bp 
Annotation by Michelle Graham. GO Biological Process: glycolysis 
SoyBase N/A ISS   
    
      GO:0006355 GO-bp 
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent 
SoyBase N/A ISS   
    
      GO:0006468 GO-bp 
Annotation by Michelle Graham. GO Biological Process: protein phosphorylation 
SoyBase N/A ISS   
    
      GO:0006612 GO-bp 
Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane 
SoyBase N/A ISS   
    
      GO:0006833 GO-bp 
Annotation by Michelle Graham. GO Biological Process: water transport 
SoyBase N/A ISS   
    
      GO:0006970 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to osmotic stress 
SoyBase N/A ISS   
    
      GO:0006972 GO-bp 
Annotation by Michelle Graham. GO Biological Process: hyperosmotic response 
SoyBase N/A ISS   
    
      GO:0007030 GO-bp 
Annotation by Michelle Graham. GO Biological Process: Golgi organization 
SoyBase N/A ISS   
    
      GO:0007112 GO-bp 
Annotation by Michelle Graham. GO Biological Process: male meiosis cytokinesis 
SoyBase N/A ISS   
    
      GO:0007154 GO-bp 
Annotation by Michelle Graham. GO Biological Process: cell communication 
SoyBase N/A ISS   
    
      GO:0007165 GO-bp 
Annotation by Michelle Graham. GO Biological Process: signal transduction 
SoyBase N/A ISS   
    
      GO:0009266 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus 
SoyBase N/A ISS   
    
      GO:0009409 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to cold 
SoyBase N/A ISS   
    
      GO:0009414 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to water deprivation 
SoyBase N/A ISS   
    
      GO:0009555 GO-bp 
Annotation by Michelle Graham. GO Biological Process: pollen development 
SoyBase N/A ISS   
    
      GO:0009595 GO-bp 
Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus 
SoyBase N/A ISS   
    
      GO:0009611 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to wounding 
SoyBase N/A ISS   
    
      GO:0009617 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to bacterium 
SoyBase N/A ISS   
    
      GO:0009620 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to fungus 
SoyBase N/A ISS   
    
      GO:0009651 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to salt stress 
SoyBase N/A ISS   
    
      GO:0009697 GO-bp 
Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process 
SoyBase N/A ISS   
    
      GO:0009723 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus 
SoyBase N/A ISS   
    
      GO:0009733 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus 
SoyBase N/A ISS   
    
      GO:0009737 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus 
SoyBase N/A ISS   
    
      GO:0009738 GO-bp 
Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway 
SoyBase N/A ISS   
    
      GO:0009753 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus 
SoyBase N/A ISS   
    
      GO:0009861 GO-bp 
Annotation by Michelle Graham. GO Biological Process: jasmonic acid and ethylene-dependent systemic resistance 
SoyBase N/A ISS   
    
      GO:0009862 GO-bp 
Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway 
SoyBase N/A ISS   
    
      GO:0009863 GO-bp 
Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway 
SoyBase N/A ISS   
    
      GO:0009867 GO-bp 
Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway 
SoyBase N/A ISS   
    
      GO:0009868 GO-bp 
Annotation by Michelle Graham. GO Biological Process: jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway 
SoyBase N/A ISS   
    
      GO:0010200 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to chitin 
SoyBase N/A ISS   
    
      GO:0010310 GO-bp 
Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process 
SoyBase N/A ISS   
    
      GO:0010363 GO-bp 
Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response 
SoyBase N/A ISS   
    
      GO:0010374 GO-bp 
Annotation by Michelle Graham. GO Biological Process: stomatal complex development 
SoyBase N/A ISS   
    
      GO:0016310 GO-bp 
Annotation by Michelle Graham. GO Biological Process: phosphorylation 
SoyBase N/A ISS   
    
      GO:0030968 GO-bp 
Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response 
SoyBase N/A ISS   
    
      GO:0031348 GO-bp 
Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response 
SoyBase N/A ISS   
    
      GO:0035304 GO-bp 
Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation 
SoyBase N/A ISS   
    
      GO:0035556 GO-bp 
Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction 
SoyBase N/A ISS   
    
      GO:0042538 GO-bp 
Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response 
SoyBase N/A ISS   
    
      GO:0042539 GO-bp 
Annotation by Michelle Graham. GO Biological Process: hypotonic salinity response 
SoyBase N/A ISS   
    
      GO:0042742 GO-bp 
Annotation by Michelle Graham. GO Biological Process: defense response to bacterium 
SoyBase N/A ISS   
    
      GO:0043069 GO-bp 
Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death 
SoyBase N/A ISS   
    
      GO:0043622 GO-bp 
Annotation by Michelle Graham. GO Biological Process: cortical microtubule organization 
SoyBase N/A ISS   
    
      GO:0043900 GO-bp 
Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process 
SoyBase N/A ISS   
    
      GO:0045088 GO-bp 
Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response 
SoyBase N/A ISS   
    
      GO:0046686 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to cadmium ion 
SoyBase N/A ISS   
    
      GO:0048481 GO-bp 
Annotation by Michelle Graham. GO Biological Process: ovule development 
SoyBase N/A ISS   
    
      GO:0050832 GO-bp 
Annotation by Michelle Graham. GO Biological Process: defense response to fungus 
SoyBase N/A ISS   
    
      GO:0051707 GO-bp 
Annotation by Michelle Graham. GO Biological Process: response to other organism 
SoyBase N/A ISS   
    
      GO:0005634 GO-cc 
Annotation by Michelle Graham. GO Cellular Compartment: nucleus 
SoyBase N/A ISS   
    
      GO:0005737 GO-cc 
Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm 
SoyBase N/A ISS   
    
      GO:0005829 GO-cc 
Annotation by Michelle Graham. GO Cellular Compartment: cytosol 
SoyBase N/A ISS   
    
      GO:0004672 GO-mf 
Annotation by Michelle Graham. GO Molecular Function: protein kinase activity 
SoyBase N/A ISS   
    
      GO:0004707 GO-mf 
Annotation by Michelle Graham. GO Molecular Function: MAP kinase activity 
SoyBase N/A ISS   
    
      GO:0005515 GO-mf 
Annotation by Michelle Graham. GO Molecular Function: protein binding 
SoyBase N/A ISS   
    
      GO:0016301 GO-mf 
Annotation by Michelle Graham. GO Molecular Function: kinase activity 
SoyBase N/A ISS   
    
      KOG0660 
KOG 
Mitogen-activated protein kinase 
JGI  ISS   
    
      PTHR24055 Panther 
MITOGEN-ACTIVATED PROTEIN KINASE 
JGI  ISS   
    
      PTHR24055:SF69 Panther 
JGI  ISS   
    
      PF00069 PFAM 
Protein kinase domain 
JGI  ISS   
    
      UniRef100_G7KS68 UniRef 
Annotation by Michelle Graham. Most informative UniRef hit: Mitogen-activated protein kinase n=1 Tax=Medicago truncatula RepID=G7KS68_MEDTR 
SoyBase E_val: 0 ISS   
    
      UniRef100_I1MKS9 UniRef 
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MKS9_SOYBN 
SoyBase E_val: 0 ISS   
Proteins Associated with Glyma16g03670
      
    Locus Gene Symbol Protein Name 
      MPK4a  Mitogen-activated protein kinase kinase 4 gene a 
     
Expression Patterns of Glyma16g03670 
Gene expression representations made with eFP at the University of Toronto.  Waese et al. 2017, Plant Cell 29(8):1806-1821  ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology 
 
To see more experiments click HERE  Paralogs of Glyma16g03670
      
    Paralog Evidence Comments 
      Glyma07g07270  IGC  Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. 
     
Gene model name correspondences to Glyma16g03670 Gene Call Version Wm82.a1.v1.1
      
    Corresponding Name Annotation Version Evidence Comments 
      Glyma.16g032900  Wm82.a2.v1 IGC  As supplied by JGI 
     
References for Glyma16g03670
     
Coding sequences of Glyma16g03670
 Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences 
		>Glyma16g03670.1   sequence type=CDS   gene model=Glyma16g03670   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGTCTGCTGTTGAGTCAGCTGAACACAACAACATCAGAGGAGTACCAACTCATGGTGGACGCTATGTTCAGTACAATATCTATGGCAATCTCTTCGAAGTTTCCAGAAAGTATGTCCCTCCTATTCGCCCTGTCGGTAGAGGTGCTTATGGTATTGTTTGCGCTGCTGTAAATGCAGAGACAGGCGAGGAAGTTGCCATTAAGAAGATTGGCAATGCATTCGACAACAGAATAGATGCCAAAAGGACCTTACGGGAAATTAAACTTCTTCGGCACATGGATCATGCAAATATTATGTCCATTAAAGATATTATACGTCCTCCACAGAAGGAAAACTTCAATGATGTGTACCTTGTTTCTGAGTTAATGGACACAGATCTGCATCAAATAATTCGTTCCAATCAGCAATTGACTGATGATCATTGTCGGTATTTTCTGTATCAATTGTTACGAGGGCTCAAATATGTACATTCAGCAAATGTTTTGCACCGAGATCTAAAGCCTAGTAATTTGCTATTGAATGCCAATTGTGACCTTAAGATTGCGGACTTTGGTCTTGCTAGAACCACATCTGAAACTGACTTTATGACTGAGTATGTGGTCACTAGATGGTACCGAGCTCCCGAATTGCTTCTTAATTGTTCAGAATATACAGCAGCCATTGATATATGGTCTGTTGGTTGCATACTTGGTGAAATCATAACAAGACAACCGCTCTTTCCTGGCAAAGATTATGTTCATCAGCTGAGACTTATCACAGAGCTGATAGGTTCGCCAGATGATGCCAGCCTTGGATTTCTACGAAGTGATAATGCTCGTAGATACGTAAAACAGCTTCCGCAGTATCCAAAACAAAACTTTTCTGCTAGATTTCCCACCATGTCTCCTGGTGCGGTTGACTTGCTAGAGAAGATGCTCATCTTTGATCCAAACAGGCGTATTACAGTTGACGAGGCGTTGAGCCACCCATACATGTCACCTCTCCATGACATCAATGAGGAACCTGTTTGCACCAGACCTTTCAGTTTTGACTTTGAGCAACCATCATTCACTGAAGAAGACATCAAGGAACTCATCTGGAGAGAATCTGTGAAGTTCAATCCTGTTCCACCAGTCTACTGA
 Predicted protein sequences of Glyma16g03670
 Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences 
		>Glyma16g03670.1   sequence type=predicted peptide   gene model=Glyma16g03670   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSAVESAEHNNIRGVPTHGGRYVQYNIYGNLFEVSRKYVPPIRPVGRGAYGIVCAAVNAETGEEVAIKKIGNAFDNRIDAKRTLREIKLLRHMDHANIMSIKDIIRPPQKENFNDVYLVSELMDTDLHQIIRSNQQLTDDHCRYFLYQLLRGLKYVHSANVLHRDLKPSNLLLNANCDLKIADFGLARTTSETDFMTEYVVTRWYRAPELLLNCSEYTAAIDIWSVGCILGEIITRQPLFPGKDYVHQLRLITELIGSPDDASLGFLRSDNARRYVKQLPQYPKQNFSARFPTMSPGAVDLLEKMLIFDPNRRITVDEALSHPYMSPLHDINEEPVCTRPFSFDFEQPSFTEEDIKELIWRESVKFNPVPPVY*