Warning : Undefined variable $sxsome in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $sstart in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : Undefined variable $send in
/var/www/html/include/SeqFeatClass.php on line
665
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g03670): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1018
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1019
Warning : get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g03670): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in
/var/www/html/include/SeqFeatClass.php on line
1020
Warning : Trying to access array offset on false in
/var/www/html/include/SeqFeatClass.php on line
1021
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1025
Deprecated : preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in
/var/www/html/include/SeqFeatClass.php on line
1031
Report for Sequence Feature Glyma16g03670
Feature Type: gene_model
Chromosome: Gm16
Start: 3084963
stop: 3092540
Source: JGI
Version: Wm82.a1.v1.1
High confidence: yes
A newer version of this gene model can be found here:
Annotations for Glyma16g03670
Database ID Annotation Type Annotation Description Annotation Source Match Score Evidence Code
AT4G01370 AT
Annotation by Michelle Graham. TAIR10: MAP kinase 4 | chr4:567219-568889 FORWARD LENGTH=376
SoyBase E_val: 0 ISS
GO:0000165 GO-bp
Annotation by Michelle Graham. GO Biological Process: MAPK cascade
SoyBase N/A ISS
GO:0006096 GO-bp
Annotation by Michelle Graham. GO Biological Process: glycolysis
SoyBase N/A ISS
GO:0006355 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent
SoyBase N/A ISS
GO:0006468 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein phosphorylation
SoyBase N/A ISS
GO:0006612 GO-bp
Annotation by Michelle Graham. GO Biological Process: protein targeting to membrane
SoyBase N/A ISS
GO:0006833 GO-bp
Annotation by Michelle Graham. GO Biological Process: water transport
SoyBase N/A ISS
GO:0006970 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to osmotic stress
SoyBase N/A ISS
GO:0006972 GO-bp
Annotation by Michelle Graham. GO Biological Process: hyperosmotic response
SoyBase N/A ISS
GO:0007030 GO-bp
Annotation by Michelle Graham. GO Biological Process: Golgi organization
SoyBase N/A ISS
GO:0007112 GO-bp
Annotation by Michelle Graham. GO Biological Process: male meiosis cytokinesis
SoyBase N/A ISS
GO:0007154 GO-bp
Annotation by Michelle Graham. GO Biological Process: cell communication
SoyBase N/A ISS
GO:0007165 GO-bp
Annotation by Michelle Graham. GO Biological Process: signal transduction
SoyBase N/A ISS
GO:0009266 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to temperature stimulus
SoyBase N/A ISS
GO:0009409 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to cold
SoyBase N/A ISS
GO:0009414 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to water deprivation
SoyBase N/A ISS
GO:0009555 GO-bp
Annotation by Michelle Graham. GO Biological Process: pollen development
SoyBase N/A ISS
GO:0009595 GO-bp
Annotation by Michelle Graham. GO Biological Process: detection of biotic stimulus
SoyBase N/A ISS
GO:0009611 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to wounding
SoyBase N/A ISS
GO:0009617 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to bacterium
SoyBase N/A ISS
GO:0009620 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to fungus
SoyBase N/A ISS
GO:0009651 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to salt stress
SoyBase N/A ISS
GO:0009697 GO-bp
Annotation by Michelle Graham. GO Biological Process: salicylic acid biosynthetic process
SoyBase N/A ISS
GO:0009723 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus
SoyBase N/A ISS
GO:0009733 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus
SoyBase N/A ISS
GO:0009737 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus
SoyBase N/A ISS
GO:0009738 GO-bp
Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway
SoyBase N/A ISS
GO:0009753 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus
SoyBase N/A ISS
GO:0009861 GO-bp
Annotation by Michelle Graham. GO Biological Process: jasmonic acid and ethylene-dependent systemic resistance
SoyBase N/A ISS
GO:0009862 GO-bp
Annotation by Michelle Graham. GO Biological Process: systemic acquired resistance, salicylic acid mediated signaling pathway
SoyBase N/A ISS
GO:0009863 GO-bp
Annotation by Michelle Graham. GO Biological Process: salicylic acid mediated signaling pathway
SoyBase N/A ISS
GO:0009867 GO-bp
Annotation by Michelle Graham. GO Biological Process: jasmonic acid mediated signaling pathway
SoyBase N/A ISS
GO:0009868 GO-bp
Annotation by Michelle Graham. GO Biological Process: jasmonic acid and ethylene-dependent systemic resistance, jasmonic acid mediated signaling pathway
SoyBase N/A ISS
GO:0010200 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to chitin
SoyBase N/A ISS
GO:0010310 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of hydrogen peroxide metabolic process
SoyBase N/A ISS
GO:0010363 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of plant-type hypersensitive response
SoyBase N/A ISS
GO:0010374 GO-bp
Annotation by Michelle Graham. GO Biological Process: stomatal complex development
SoyBase N/A ISS
GO:0016310 GO-bp
Annotation by Michelle Graham. GO Biological Process: phosphorylation
SoyBase N/A ISS
GO:0030968 GO-bp
Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response
SoyBase N/A ISS
GO:0031348 GO-bp
Annotation by Michelle Graham. GO Biological Process: negative regulation of defense response
SoyBase N/A ISS
GO:0035304 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation
SoyBase N/A ISS
GO:0035556 GO-bp
Annotation by Michelle Graham. GO Biological Process: intracellular signal transduction
SoyBase N/A ISS
GO:0042538 GO-bp
Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response
SoyBase N/A ISS
GO:0042539 GO-bp
Annotation by Michelle Graham. GO Biological Process: hypotonic salinity response
SoyBase N/A ISS
GO:0042742 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response to bacterium
SoyBase N/A ISS
GO:0043069 GO-bp
Annotation by Michelle Graham. GO Biological Process: negative regulation of programmed cell death
SoyBase N/A ISS
GO:0043622 GO-bp
Annotation by Michelle Graham. GO Biological Process: cortical microtubule organization
SoyBase N/A ISS
GO:0043900 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of multi-organism process
SoyBase N/A ISS
GO:0045088 GO-bp
Annotation by Michelle Graham. GO Biological Process: regulation of innate immune response
SoyBase N/A ISS
GO:0046686 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to cadmium ion
SoyBase N/A ISS
GO:0048481 GO-bp
Annotation by Michelle Graham. GO Biological Process: ovule development
SoyBase N/A ISS
GO:0050832 GO-bp
Annotation by Michelle Graham. GO Biological Process: defense response to fungus
SoyBase N/A ISS
GO:0051707 GO-bp
Annotation by Michelle Graham. GO Biological Process: response to other organism
SoyBase N/A ISS
GO:0005634 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: nucleus
SoyBase N/A ISS
GO:0005737 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm
SoyBase N/A ISS
GO:0005829 GO-cc
Annotation by Michelle Graham. GO Cellular Compartment: cytosol
SoyBase N/A ISS
GO:0004672 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein kinase activity
SoyBase N/A ISS
GO:0004707 GO-mf
Annotation by Michelle Graham. GO Molecular Function: MAP kinase activity
SoyBase N/A ISS
GO:0005515 GO-mf
Annotation by Michelle Graham. GO Molecular Function: protein binding
SoyBase N/A ISS
GO:0016301 GO-mf
Annotation by Michelle Graham. GO Molecular Function: kinase activity
SoyBase N/A ISS
KOG0660
KOG
Mitogen-activated protein kinase
JGI ISS
PTHR24055 Panther
MITOGEN-ACTIVATED PROTEIN KINASE
JGI ISS
PTHR24055:SF69 Panther
JGI ISS
PF00069 PFAM
Protein kinase domain
JGI ISS
UniRef100_G7KS68 UniRef
Annotation by Michelle Graham. Most informative UniRef hit: Mitogen-activated protein kinase n=1 Tax=Medicago truncatula RepID=G7KS68_MEDTR
SoyBase E_val: 0 ISS
UniRef100_I1MKS9 UniRef
Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MKS9_SOYBN
SoyBase E_val: 0 ISS
Proteins Associated with Glyma16g03670
Locus Gene Symbol Protein Name
MPK4a Mitogen-activated protein kinase kinase 4 gene a
Expression Patterns of Glyma16g03670
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
To see more experiments click HERE
Paralogs of Glyma16g03670
Paralog Evidence Comments
Glyma07g07270 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.
Gene model name correspondences to Glyma16g03670 Gene Call Version Wm82.a1.v1.1
Corresponding Name Annotation Version Evidence Comments
Glyma.16g032900 Wm82.a2.v1 IGC As supplied by JGI
References for Glyma16g03670
Coding sequences of Glyma16g03670
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NT Limit To All Plant Sequences
>Glyma16g03670.1 sequence type=CDS gene model=Glyma16g03670 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
ATGTCTGCTGTTGAGTCAGCTGAACACAACAACATCAGAGGAGTACCAACTCATGGTGGACGCTATGTTCAGTACAATATCTATGGCAATCTCTTCGAAGTTTCCAGAAAGTATGTCCCTCCTATTCGCCCTGTCGGTAGAGGTGCTTATGGTATTGTTTGCGCTGCTGTAAATGCAGAGACAGGCGAGGAAGTTGCCATTAAGAAGATTGGCAATGCATTCGACAACAGAATAGATGCCAAAAGGACCTTACGGGAAATTAAACTTCTTCGGCACATGGATCATGCAAATATTATGTCCATTAAAGATATTATACGTCCTCCACAGAAGGAAAACTTCAATGATGTGTACCTTGTTTCTGAGTTAATGGACACAGATCTGCATCAAATAATTCGTTCCAATCAGCAATTGACTGATGATCATTGTCGGTATTTTCTGTATCAATTGTTACGAGGGCTCAAATATGTACATTCAGCAAATGTTTTGCACCGAGATCTAAAGCCTAGTAATTTGCTATTGAATGCCAATTGTGACCTTAAGATTGCGGACTTTGGTCTTGCTAGAACCACATCTGAAACTGACTTTATGACTGAGTATGTGGTCACTAGATGGTACCGAGCTCCCGAATTGCTTCTTAATTGTTCAGAATATACAGCAGCCATTGATATATGGTCTGTTGGTTGCATACTTGGTGAAATCATAACAAGACAACCGCTCTTTCCTGGCAAAGATTATGTTCATCAGCTGAGACTTATCACAGAGCTGATAGGTTCGCCAGATGATGCCAGCCTTGGATTTCTACGAAGTGATAATGCTCGTAGATACGTAAAACAGCTTCCGCAGTATCCAAAACAAAACTTTTCTGCTAGATTTCCCACCATGTCTCCTGGTGCGGTTGACTTGCTAGAGAAGATGCTCATCTTTGATCCAAACAGGCGTATTACAGTTGACGAGGCGTTGAGCCACCCATACATGTCACCTCTCCATGACATCAATGAGGAACCTGTTTGCACCAGACCTTTCAGTTTTGACTTTGAGCAACCATCATTCACTGAAGAAGACATCAAGGAACTCATCTGGAGAGAATCTGTGAAGTTCAATCCTGTTCCACCAGTCTACTGA
Predicted protein sequences of Glyma16g03670
Show Sequence BLAST Sequence at SoyBase BLAST Sequence against GenBank NR Limit To All Plant Sequences
>Glyma16g03670.1 sequence type=predicted peptide gene model=Glyma16g03670 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high
MSAVESAEHNNIRGVPTHGGRYVQYNIYGNLFEVSRKYVPPIRPVGRGAYGIVCAAVNAETGEEVAIKKIGNAFDNRIDAKRTLREIKLLRHMDHANIMSIKDIIRPPQKENFNDVYLVSELMDTDLHQIIRSNQQLTDDHCRYFLYQLLRGLKYVHSANVLHRDLKPSNLLLNANCDLKIADFGLARTTSETDFMTEYVVTRWYRAPELLLNCSEYTAAIDIWSVGCILGEIITRQPLFPGKDYVHQLRLITELIGSPDDASLGFLRSDNARRYVKQLPQYPKQNFSARFPTMSPGAVDLLEKMLIFDPNRRITVDEALSHPYMSPLHDINEEPVCTRPFSFDFEQPSFTEEDIKELIWRESVKFNPVPPVY*