SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma16g03190

Feature Type:gene_model
Chromosome:Gm16
Start:2746133
stop:2751663
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma16g03190
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT2G46270AT Annotation by Michelle Graham. TAIR10: G-box binding factor 3 | chr2:19000859-19002901 FORWARD LENGTH=382 SoyBaseE_val: 5.00E-118ISS
GO:0000303GO-bp Annotation by Michelle Graham. GO Biological Process: response to superoxide SoyBaseN/AISS
GO:0006351GO-bp Annotation by Michelle Graham. GO Biological Process: transcription, DNA-dependent SoyBaseN/AISS
GO:0006355GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0007165GO-bp Annotation by Michelle Graham. GO Biological Process: signal transduction SoyBaseN/AISS
GO:0009410GO-bp Annotation by Michelle Graham. GO Biological Process: response to xenobiotic stimulus SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0009611GO-bp Annotation by Michelle Graham. GO Biological Process: response to wounding SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0009723GO-bp Annotation by Michelle Graham. GO Biological Process: response to ethylene stimulus SoyBaseN/AISS
GO:0009733GO-bp Annotation by Michelle Graham. GO Biological Process: response to auxin stimulus SoyBaseN/AISS
GO:0009737GO-bp Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus SoyBaseN/AISS
GO:0009738GO-bp Annotation by Michelle Graham. GO Biological Process: abscisic acid mediated signaling pathway SoyBaseN/AISS
GO:0009743GO-bp Annotation by Michelle Graham. GO Biological Process: response to carbohydrate stimulus SoyBaseN/AISS
GO:0009753GO-bp Annotation by Michelle Graham. GO Biological Process: response to jasmonic acid stimulus SoyBaseN/AISS
GO:0009873GO-bp Annotation by Michelle Graham. GO Biological Process: ethylene mediated signaling pathway SoyBaseN/AISS
GO:0030968GO-bp Annotation by Michelle Graham. GO Biological Process: endoplasmic reticulum unfolded protein response SoyBaseN/AISS
GO:0042538GO-bp Annotation by Michelle Graham. GO Biological Process: hyperosmotic salinity response SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0003700GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding transcription factor activity SoyBaseN/AISS
GO:0043565GO-mf Annotation by Michelle Graham. GO Molecular Function: sequence-specific DNA binding SoyBaseN/AISS
GO:0046983GO-mf Annotation by Michelle Graham. GO Molecular Function: protein dimerization activity SoyBaseN/AISS
PTHR22952Panther CAMP-RESPONSE ELEMENT BINDING PROTEIN-RELATED JGI ISS
PTHR22952:SF73Panther GBF2 (G-BOX BINDING FACTOR 2), DNA BINDING / TRANS JGI ISS
PF00170PFAM bZIP transcription factor JGI ISS
PF07777PFAM G-box binding protein MFMR JGI ISS
UniRef100_I1MKN5UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MKN5_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q43450UniRef Annotation by Michelle Graham. Most informative UniRef hit: G-box binding factor (Fragment) n=1 Tax=Glycine max RepID=Q43450_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma16g03190
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma16g03190
ParalogEvidenceComments
Glyma07g06620 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma16g03190 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g029000 Wm82.a2.v1IGC As supplied by JGI

References for Glyma16g03190
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma16g03190
>Glyma16g03190.1   sequence type=CDS   gene model=Glyma16g03190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGAAACAGTGAGGAAGAGAAATCTGTTAAAACTGGAAGTCCTTCTTCTTCACCTGCAACAACTGAGCAGACCAACCAACCTAATATTCACGTCTATCCTGATTGGGCTGCCATGCAGTATTATGGGCCAAGAGTCAACATTCCACCATACTTCAACTCAGCTGTGGCTTCTGGTCATGCTCCACACCCATACATGTGGGGGCCGCCACAGCCTATGATGCAACCTTATGGGCCACCTTATGCAGCATTTTATTCGCATGGAGGGGTTTATACTCACCCTGCAGTTGCTATTGGGCCACACTCACATGGTCAAGGAGTTCCATCTTCACCTGCTGCTGGGACTCCTTCAAGCGTAGAATCACCAACCAAATTCTCTGGAAATACTAATCAGGGTTTAGTGAAGAAATTGAAAGGGTTTGATGAGCTTGCAATGTCAATAGGCAATTGCAATGCTGAGAGTGCTGAGCGAGGAGCTGAAAACAGGCTGTCACAGAGTGTGGATACTGAGGGTTCCAGCGACGGAAGTGATGGCAACACTGCAGGGGCTAATCAAACAAAAAGGAAAAGAAGCCGAGAAGGAACACCGATCACTGATGCAGAAGGGAAAACTGAGCTACAAAATGGTCCGGCTTCCAAAGAGACTGCATCTTCCAAAAAGATTGTGTCAGCTACCCCAGCTAGTGTTGCAGGAACATTAGTTGGACCTGTAGTTTCTTCAGGTATGGCCACAGCACTGGAGCTGAGGAACCCTTCGACTGTTCATTCTAAGGCAAATTCCACAAGTGCCGCACAACCTTGTGCAGTTGTGCGTAATGAAACTTGGTTACAGAATGAGCGTGAGCTGAAACGGGAGAGGAGAAAACAATCTAACCGTGAATCTGCTAGAAGGTCCAGGCTGAGGAAGCAGGCCGAGACTGAAGAATTGGCACGAAAAGTTGAGATGTTAACTGCTGAGAATGTGTCTCTGAAGTCAGAAATAACTCGACTGACTGAAGGTTCTGAGCAGATGAGGATGGAAAATTCTGCATTGAGGGAAAAACTGATAAATACTCAACTGGGACCAAGGGAAGAGATAACTTTGAGCAGCATTGACAGCAAGAGGGCTGCACCTGTAAGTACAGAAAACTTGTTATCAAGAGTTAACAATTCCGGAGCTAATGATAGAACTGCAGAGAATGAGAATGATATCTGCGAGAACAAACCAAATTCTGGTGCAAAGCTGCATCAACTACTGGATACAAATCCTAGAGCTAATGCTGTAGCAGCTGGTTGA
Predicted protein sequences of Glyma16g03190
>Glyma16g03190.1   sequence type=predicted peptide   gene model=Glyma16g03190   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGNSEEEKSVKTGSPSSSPATTEQTNQPNIHVYPDWAAMQYYGPRVNIPPYFNSAVASGHAPHPYMWGPPQPMMQPYGPPYAAFYSHGGVYTHPAVAIGPHSHGQGVPSSPAAGTPSSVESPTKFSGNTNQGLVKKLKGFDELAMSIGNCNAESAERGAENRLSQSVDTEGSSDGSDGNTAGANQTKRKRSREGTPITDAEGKTELQNGPASKETASSKKIVSATPASVAGTLVGPVVSSGMATALELRNPSTVHSKANSTSAAQPCAVVRNETWLQNERELKRERRKQSNRESARRSRLRKQAETEELARKVEMLTAENVSLKSEITRLTEGSEQMRMENSALREKLINTQLGPREEITLSSIDSKRAAPVSTENLLSRVNNSGANDRTAENENDICENKPNSGAKLHQLLDTNPRANAVAAG*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo