SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g03160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g03160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g03160

Feature Type:gene_model
Chromosome:Gm16
Start:2730247
stop:2736496
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G25530AT Annotation by Michelle Graham. TAIR10: glyoxylate reductase 1 | chr3:9271949-9273514 REVERSE LENGTH=289 SoyBaseE_val: 9.00E-168ISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006573GO-bp Annotation by Michelle Graham. GO Biological Process: valine metabolic process SoyBaseN/AISS
GO:0006979GO-bp Annotation by Michelle Graham. GO Biological Process: response to oxidative stress SoyBaseN/AISS
GO:0007020GO-bp Annotation by Michelle Graham. GO Biological Process: microtubule nucleation SoyBaseN/AISS
GO:0019288GO-bp Annotation by Michelle Graham. GO Biological Process: isopentenyl diphosphate biosynthetic process, mevalonate-independent pathway SoyBaseN/AISS
GO:0019344GO-bp Annotation by Michelle Graham. GO Biological Process: cysteine biosynthetic process SoyBaseN/AISS
GO:0055114GO-bp Annotation by Michelle Graham. GO Biological Process: oxidation-reduction process SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005829GO-cc Annotation by Michelle Graham. GO Cellular Compartment: cytosol SoyBaseN/AISS
GO:0000166GO-mf Annotation by Michelle Graham. GO Molecular Function: nucleotide binding SoyBaseN/AISS
GO:0003858GO-mf Annotation by Michelle Graham. GO Molecular Function: 3-hydroxybutyrate dehydrogenase activity SoyBaseN/AISS
GO:0004616GO-mf Annotation by Michelle Graham. GO Molecular Function: phosphogluconate dehydrogenase (decarboxylating) activity SoyBaseN/AISS
GO:0008442GO-mf Annotation by Michelle Graham. GO Molecular Function: 3-hydroxyisobutyrate dehydrogenase activity SoyBaseN/AISS
GO:0016491GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity SoyBaseN/AISS
GO:0016616GO-mf Annotation by Michelle Graham. GO Molecular Function: oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor SoyBaseN/AISS
GO:0050662GO-mf Annotation by Michelle Graham. GO Molecular Function: coenzyme binding SoyBaseN/AISS
KOG0409 KOG Predicted dehydrogenase JGI ISS
PTHR22981Panther 3-HYDROXYISOBUTYRATE DEHYDROGENASE-RELATED JGI ISS
PTHR22981:SF13Panther 3-HYDROXYISOBUTYRATE DEHYDROGENASE JGI ISS
PF03446PFAM NAD binding domain of 6-phosphogluconate dehydrogenase JGI ISS
UniRef100_I1MKN2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MKN2_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q84VC8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Gamma hydroxybutyrate dehydrogenase-like protein n=2 Tax=Oryza sativa RepID=Q84VC8_ORYSJ SoyBaseE_val: 2.00E-172ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g03160 not represented in the dataset

Glyma16g03160 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma07g06570 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g028700 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g03160.1   sequence type=CDS   gene model=Glyma16g03160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGAGGTTGGATTTTTGGGTTTGGGGATAATGGGCAAGGCTATGGCAATCAATCTTCTACGCCATGGCTTCAAAGTCACTGTTTGGAACAGAACCCTCTCCAAGTGTGACGAACTCGTGCAACATGGTGCTTCAGTTGGAGAAACCCCAGCAACTGTAGTCAAGAAATGCAAGTATACAATTGCAATGTTATCTGATCCTTCGGCTGCTTTATCGGTTGTGTTTGATAATGATGGTGTTCTTGAGCATATTAATGGAAAAGGTTATATTGACATGTCAACAGTTAATGCTGATACATCTTCCAAAATATCTGAGGCTATCAAAGCAAAAGGTGGTTACTTCCTTGAAGGTCCTGTTTCGGGTAGCAAGAAGCCTGCAGAAGATGGCCAACTCATAATACTTGCTGCTGGACATAAGGCATTGTATGATGAAGTGCTTCCAGCATTTGATATACTGGGGAAGAAGTCTTTCTTTCTGGGTGAGGTTGGAAATGGTGCAAAAATGAAACTAGTTGTTAACATGATAATGGGCAGTATGATGAATGCTTTCTCTGAGGGAATCACACTAGCTGAAAGAAGTGGTTTGAACCCTGGTACTCTTCTTGATGTGCTGGATCTTGGTGCCATAAGTAACGGCATGTTTAAATTGAAAGGACCTACAATGCTCCAAAACAGTTATTCCCCAGCTTTTCCGCTGAAACACCAGCAGAAGGACATGAGATTAGCTCTTGCCCTTGGAGATGAAAATGCTGTATCAATGCCAGTAGCAGCTGCAGCAAACGAGGCTTTCAAGAAAGCCAGAAGCATGGGGTTGGGAGACCTTGATTTTTCAGCAGTTCATGAGACTTTGAAAGCTCCTGATCATTCATCTTGA

>Glyma16g03160.1   sequence type=predicted peptide   gene model=Glyma16g03160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MEVGFLGLGIMGKAMAINLLRHGFKVTVWNRTLSKCDELVQHGASVGETPATVVKKCKYTIAMLSDPSAALSVVFDNDGVLEHINGKGYIDMSTVNADTSSKISEAIKAKGGYFLEGPVSGSKKPAEDGQLIILAAGHKALYDEVLPAFDILGKKSFFLGEVGNGAKMKLVVNMIMGSMMNAFSEGITLAERSGLNPGTLLDVLDLGAISNGMFKLKGPTMLQNSYSPAFPLKHQQKDMRLALALGDENAVSMPVAAAANEAFKKARSMGLGDLDFSAVHETLKAPDHSS*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo