SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g03020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g03020): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g03020

Feature Type:gene_model
Chromosome:Gm16
Start:2608774
stop:2613364
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT4G01100AT Annotation by Michelle Graham. TAIR10: adenine nucleotide transporter 1 | chr4:477411-479590 FORWARD LENGTH=352 SoyBaseE_val: 0ISS
GO:0006007GO-bp Annotation by Michelle Graham. GO Biological Process: glucose catabolic process SoyBaseN/AISS
GO:0006096GO-bp Annotation by Michelle Graham. GO Biological Process: glycolysis SoyBaseN/AISS
GO:0006098GO-bp Annotation by Michelle Graham. GO Biological Process: pentose-phosphate shunt SoyBaseN/AISS
GO:0006810GO-bp Annotation by Michelle Graham. GO Biological Process: transport SoyBaseN/AISS
GO:0006839GO-bp Annotation by Michelle Graham. GO Biological Process: mitochondrial transport SoyBaseN/AISS
GO:0009060GO-bp Annotation by Michelle Graham. GO Biological Process: aerobic respiration SoyBaseN/AISS
GO:0009651GO-bp Annotation by Michelle Graham. GO Biological Process: response to salt stress SoyBaseN/AISS
GO:0015866GO-bp Annotation by Michelle Graham. GO Biological Process: ADP transport SoyBaseN/AISS
GO:0015867GO-bp Annotation by Michelle Graham. GO Biological Process: ATP transport SoyBaseN/AISS
GO:0046686GO-bp Annotation by Michelle Graham. GO Biological Process: response to cadmium ion SoyBaseN/AISS
GO:0055085GO-bp Annotation by Michelle Graham. GO Biological Process: transmembrane transport SoyBaseN/AISS
GO:0080121GO-bp Annotation by Michelle Graham. GO Biological Process: AMP transport SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005743GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrial inner membrane SoyBaseN/AISS
GO:0005774GO-cc Annotation by Michelle Graham. GO Cellular Compartment: vacuolar membrane SoyBaseN/AISS
GO:0009536GO-cc Annotation by Michelle Graham. GO Cellular Compartment: plastid SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0005347GO-mf Annotation by Michelle Graham. GO Molecular Function: ATP transmembrane transporter activity SoyBaseN/AISS
GO:0015217GO-mf Annotation by Michelle Graham. GO Molecular Function: ADP transmembrane transporter activity SoyBaseN/AISS
GO:0080122GO-mf Annotation by Michelle Graham. GO Molecular Function: AMP transmembrane transporter activity SoyBaseN/AISS
KOG0752 KOG Mitochondrial solute carrier protein JGI ISS
PTHR24089Panther FAMILY NOT NAMED JGI ISS
PTHR24089:SF87Panther SUBFAMILY NOT NAMED JGI ISS
PF00153PFAM Mitochondrial carrier protein JGI ISS
UniRef100_B9T344UniRef Annotation by Michelle Graham. Most informative UniRef hit: Grave disease carrier protein, putative n=1 Tax=Ricinus communis RepID=B9T344_RICCO SoyBaseE_val: 0ISS
UniRef100_I1MKL8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MKL8_SOYBN SoyBaseE_val: 0ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g03020 not represented in the dataset

Glyma16g03020 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma07g06410 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g027100 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g03020.1   sequence type=CDS   gene model=Glyma16g03020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCGGAGAATGTGAAGACCGGGGATTCGGCCGTGACGACGATCGTCAATCTCGCCGAGGAGGCCAAGCTCGCCAGGGAAGGCGTCGTCAAGGCTCCCAGCTACGCCCTCGCCAGCATCTGCAAGTCGCTCGTCGCCGGTGGCGTCGCCGGAGGAGTGTCACGTACTGCAGTTGCTCCTCTGGAACGATTGAAAATTTTGCTGCAGGTCCAGAATCCTCATAACATTAAATACAACGGAACAGTACAAGGCCTAAAATATATATGGAGAACTGAAGGATTCCGTGGACTTTTCAAAGGGAATGGTACTAATTGTGCTAGAATTGTCCCTAATTCTGCTGTGAAGTTCTTCAGTTATGAGCAAGCTTCTAAAGGTATACTGCATCTGTATAAGCAGCAAACTGGAAATGAGGATGCTCAGCTGACTCCTCTTTTACGCCTTGGAGCTGGAGCTTGTGCTGGAATAATTGCTATGTCTGCAACTTATCCAATGGATATGGTTCGAGGCAGGATTACTGTGCAGACTGAGGCATCCCCATATCAGTACAGAGGAATGTTTCATGCTTTGTCTACTGTGCTCAGGGAAGAAGGTGCTCGTGCTTTATATAAGGGTTGGCTTCCTTCAGTTATTGGAGTTATTCCTTATGTAGGTCTCAACTTTGCTGTCTATGAGTCTCTGAAAGATTATTTAATTAAATCCAACCCATTTGATCTAGTTGAAAATTCTGAGTTGAGTGTGACAACACGCCTGGCTTGTGGTGCTGCTGCTGGAACTGTTGGACAAACTGTTGCTTACCCTCTTGATGTTATTCGTCGAAGAATGCAGATGGTTGGTTGGAACCACGCTGCTTCTGTTCTAACTGGTGATGGAAGAGGCAAAGTCCCACTTGAATACACTGGAATGATTGATGCATTCAGAAAAACTGTTCAGCACGAGGGATTTGGTGCATTATACAAGGGTCTGGTGCCCAACTCTGTAAAGGTGGTCCCATCGATAGCAATTGCATTCGTAACATATGAGGTTGTGAAAGACGTTTTAGGAGTTGAGATCAGAATATCCGACTAA

>Glyma16g03020.1   sequence type=predicted peptide   gene model=Glyma16g03020   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASENVKTGDSAVTTIVNLAEEAKLAREGVVKAPSYALASICKSLVAGGVAGGVSRTAVAPLERLKILLQVQNPHNIKYNGTVQGLKYIWRTEGFRGLFKGNGTNCARIVPNSAVKFFSYEQASKGILHLYKQQTGNEDAQLTPLLRLGAGACAGIIAMSATYPMDMVRGRITVQTEASPYQYRGMFHALSTVLREEGARALYKGWLPSVIGVIPYVGLNFAVYESLKDYLIKSNPFDLVENSELSVTTRLACGAAAGTVGQTVAYPLDVIRRRMQMVGWNHAASVLTGDGRGKVPLEYTGMIDAFRKTVQHEGFGALYKGLVPNSVKVVPSIAIAFVTYEVVKDVLGVEIRISD*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo