SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma16g01870

Feature Type:gene_model
Chromosome:Gm16
Start:1396338
stop:1398872
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma16g01870
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G61470AT Annotation by Michelle Graham. TAIR10: photosystem I light harvesting complex gene 2 | chr3:22745736-22747032 FORWARD LENGTH=257 SoyBaseE_val: 4.00E-147ISS
GO:0009765GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light harvesting SoyBaseN/AISS
GO:0009768GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis, light harvesting in photosystem I SoyBaseN/AISS
GO:0015979GO-bp Annotation by Michelle Graham. GO Biological Process: photosynthesis SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0009534GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid SoyBaseN/AISS
GO:0009535GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast thylakoid membrane SoyBaseN/AISS
GO:0009579GO-cc Annotation by Michelle Graham. GO Cellular Compartment: thylakoid SoyBaseN/AISS
GO:0009782GO-cc Annotation by Michelle Graham. GO Cellular Compartment: photosystem I antenna complex SoyBaseN/AISS
GO:0016020GO-cc Annotation by Michelle Graham. GO Cellular Compartment: membrane SoyBaseN/AISS
GO:0030076GO-cc Annotation by Michelle Graham. GO Cellular Compartment: light-harvesting complex SoyBaseN/AISS
GO:0016168GO-mf Annotation by Michelle Graham. GO Molecular Function: chlorophyll binding SoyBaseN/AISS
PTHR21649Panther CHLOROPHYLL A/B BINDING PROTEIN JGI ISS
PF00504PFAM Chlorophyll A-B binding protein JGI ISS
UniRef100_B9GML1UniRef Annotation by Michelle Graham. Most informative UniRef hit: Light-harvesting complex I protein Lhca2 n=1 Tax=Populus trichocarpa RepID=B9GML1_POPTR SoyBaseE_val: 7.00E-177ISS
UniRef100_C6TKB2UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6TKB2_SOYBN SoyBaseE_val: 0ISS

Expression Patterns of Glyma16g01870
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma16g01870
ParalogEvidenceComments
Glyma07g05320 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma16g01870 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g016100 Wm82.a2.v1IGC As supplied by JGI

References for Glyma16g01870
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma16g01870
>Glyma16g01870.1   sequence type=CDS   gene model=Glyma16g01870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTTCCTCGTGTGCTTCCTCTGCCATTGCAGCTGTTGCCATCTCCACACCAAGTTCCCAGAAGAATGGATCACTCTTGGGAAGCACAAAAGCTTCTTTTCTTAGTGGGAGGAAACTGAAGGTGAACAACTTTACAGCACCAGTTGGAGCACGATCCAGCACTACAGTTTGCGCAGTTGCTGAGCCTGATAGGCCTCTGTGGTTCCCAGGCAGCACCCCTCCTCCATGGCTAGATGGCAGTTTGCCAGGAGATTTTGGCTTTGATCCTCTAGGTCTTGCATCTGATCCTGAGAGCCTGAGATGGAATGTCCAAGCAGAGCTTGTGCACTGCAGATGGGCCATGTTGGGAGCTGCTGGCATTTTCATCCCAGAATTCCTCACAAAGATTGGTATCCTGAACACCCCTTCATGGTACACTGCTGGAGAGTTGGAGTACTTCACAGACACCACCACACTCTTCATAGTTGAGCTCTTTTTCATCGGTTGGGCCGAGGGTAGAAGGTGGGCTGACATCATCAAGCCAGGCTGTGTCAACACTGACCCCATCTTTCCCAACAACAAGCTCACAGGAACTGATGTTGGGTACCCAGGTGGGCTTTGGTTTGACCCACTTGGCTGGGGAAGTGGTTCTCCTGAGAAGATCAAGGAGTTGAGAACAAAGGAGATCAAGAATGGGAGGTTGGCCATGTTGGCTGTGATGGGGGCATGGTTCCAGCACATTTACACTGGCACTGGTCCTATTGACAACCTCTTTGCTCACCTTGCAGATCCTGGCCATGCTACTATTTTTGCTGCTTTCACTCCCAAGTGA
Predicted protein sequences of Glyma16g01870
>Glyma16g01870.1   sequence type=predicted peptide   gene model=Glyma16g01870   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MASSCASSAIAAVAISTPSSQKNGSLLGSTKASFLSGRKLKVNNFTAPVGARSSTTVCAVAEPDRPLWFPGSTPPPWLDGSLPGDFGFDPLGLASDPESLRWNVQAELVHCRWAMLGAAGIFIPEFLTKIGILNTPSWYTAGELEYFTDTTTLFIVELFFIGWAEGRRWADIIKPGCVNTDPIFPNNKLTGTDVGYPGGLWFDPLGWGSGSPEKIKELRTKEIKNGRLAMLAVMGAWFQHIYTGTGPIDNLFAHLADPGHATIFAAFTPK*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo