SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g01160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g01160): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g01160

Feature Type:gene_model
Chromosome:Gm16
Start:851238
stop:853145
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G14080AT Annotation by Michelle Graham. TAIR10: Small nuclear ribonucleoprotein family protein | chr3:4667717-4668989 FORWARD LENGTH=128 SoyBaseE_val: 1.00E-57ISS
GO:0010228GO-bp Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0005732GO-cc Annotation by Michelle Graham. GO Cellular Compartment: small nucleolar ribonucleoprotein complex SoyBaseN/AISS
GO:0003674GO-mf Annotation by Michelle Graham. GO Molecular Function: molecular function SoyBaseN/AISS
KOG1782 KOG Small Nuclear ribonucleoprotein splicing factor JGI ISS
PTHR15588Panther LSM1 JGI ISS
PTHR15588:SF5Panther hCP1774734: lsm1 [homo sapiens] JGI ISS
PF01423PFAM LSM domain JGI ISS
UniRef100_B9T3A8UniRef Annotation by Michelle Graham. Most informative UniRef hit: Lsm1, putative n=1 Tax=Ricinus communis RepID=B9T3A8_RICCO SoyBaseE_val: 1.00E-56ISS
UniRef100_C6SZ12UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=C6SZ12_SOYBN SoyBaseE_val: 7.00E-62ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g01160 not represented in the dataset

Glyma16g01160 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma07g04580 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.16g009500 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma16g01160.2   sequence type=CDS   gene model=Glyma16g01160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGGACACTTCGCTCTTTTGATCAATTTGCCAATGCAGTTCTTGAGGGTGCTTGTGAGAGAGTTATTGTTGGTGATCTGTATTGTGACATCCCTTTAGGTCTCTATGTGATCCGTGGGGAAAATGTTGTTCTAATTGGTGAGCTGGACTTGGAGAGGGAGGAACTTCCCGAACATATGACACGTGTTTCTACCGCAGAAATCAAGAGGGCACAGAAAGCAGAAAGGGAGGCTTCAGATCTGAAAGGGACTATGAGGAAAAGAATGGAATTCCTTGACTTTGACTAG

>Glyma16g01160.2   sequence type=predicted peptide   gene model=Glyma16g01160   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGTLRSFDQFANAVLEGACERVIVGDLYCDIPLGLYVIRGENVVLIGELDLEREELPEHMTRVSTAEIKRAQKAEREASDLKGTMRKRMEFLDFD*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo