Glyma16g00350 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma16g00350): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma16g00350): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma16g00350

Feature Type:	gene_model
Chromosome:	Gm16
Start:	99779
stop:	102238
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma16g00350

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G09630	AT	Annotation by Michelle Graham. TAIR10: RAB GTPase 11C \| chr1:3118350-3119571 REVERSE LENGTH=217	SoyBase	E_val: 3.00E-139	ISS
GO:0000910	GO-bp	Annotation by Michelle Graham. GO Biological Process: cytokinesis	SoyBase	N/A	ISS
GO:0007264	GO-bp	Annotation by Michelle Graham. GO Biological Process: small GTPase mediated signal transduction	SoyBase	N/A	ISS
GO:0015031	GO-bp	Annotation by Michelle Graham. GO Biological Process: protein transport	SoyBase	N/A	ISS
GO:0016192	GO-bp	Annotation by Michelle Graham. GO Biological Process: vesicle-mediated transport	SoyBase	N/A	ISS
GO:0019932	GO-bp	Annotation by Michelle Graham. GO Biological Process: second-messenger-mediated signaling	SoyBase	N/A	ISS
GO:0005768	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: endosome	SoyBase	N/A	ISS
GO:0005829	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cytosol	SoyBase	N/A	ISS
GO:0005886	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: plasma membrane	SoyBase	N/A	ISS
GO:0009504	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: cell plate	SoyBase	N/A	ISS
GO:0005525	GO-mf	Annotation by Michelle Graham. GO Molecular Function: GTP binding	SoyBase	N/A	ISS
KOG0087	KOG	GTPase Rab11/YPT3, small G protein superfamily	JGI		ISS
PTHR24073	Panther	FAMILY NOT NAMED	JGI		ISS
PTHR24073:SF213	Panther	SUBFAMILY NOT NAMED	JGI		ISS
PF00071	PFAM	Ras family	JGI		ISS
UniRef100_I1MJU0	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MJU0_SOYBN	SoyBase	E_val: 2.00E-157	ISS
UniRef100_Q1SL05	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: Ras GTPase; Sigma-54 factor, interaction region n=1 Tax=Medicago truncatula RepID=Q1SL05_MEDTR	SoyBase	E_val: 6.00E-135	ISS

Expression Patterns of Glyma16g00350

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma16g00350 not represented in the dataset	Glyma16g00350 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma16g00350

Paralog	Evidence	Comments
Glyma12g28660	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma16g00350 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.16g001800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma16g00350

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma16g00350

Limit To All Plant Sequences

>Glyma16g00350.1   sequence type=CDS   gene model=Glyma16g00350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCGGAGAGCAGAGGAAGAGTACGATTACCTGTTCAAGGTTGTACTGATCGGTGATTCCGGTGTTGGAAAATCCAATCTTCTGTCCCGATTCACTCGCAACGAGTTTTGCCTCGAATCCAAGTCCACCATTGGAGTCGAATTCGCCACTCGCACTCTTCAGGTGGAGGGAAGAACTGTGAAAGCTCAAATATGGGATACCGCCGGACAGGAACGATACAGAGCAATTACCAGTGCATACTACAGGGGTGCCCTTGGAGCTCTTCTAGTCTACGATGTAACTAAACCAACCACATTCGAAAACGTCAGCCGATGGCTGAAGGAGCTAAGGGATCATGCCGATGCTAACATTGTCATCATGTTGATAGGGAACAAGACCGATCTCAAGCATCTCAGAGCTGTTGCCACCGAGGATGCCCAGGGTTATTCCGAGAAGGAAGGCCTTTCTTTCATCGAGACTTCTGCTCTCGAAGCAACTAATGTTGAGAAGGCTTTCCAGACTATTCTTGCAGAGATATACCGCATTATCAGTAAGAAATCACTCTCTTCCAATGAGCCTGCATCTGCCAATATTAAAGAAGGCATGACTATCACTGTTGGGGGACCCCAATCCAACGCAAGCAAGCCTTCTTGCTGTACATCATCTTGA

Predicted protein sequences of Glyma16g00350

Limit To All Plant Sequences

>Glyma16g00350.1   sequence type=predicted peptide   gene model=Glyma16g00350   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MARRAEEEYDYLFKVVLIGDSGVGKSNLLSRFTRNEFCLESKSTIGVEFATRTLQVEGRTVKAQIWDTAGQERYRAITSAYYRGALGALLVYDVTKPTTFENVSRWLKELRDHADANIVIMLIGNKTDLKHLRAVATEDAQGYSEKEGLSFIETSALEATNVEKAFQTILAEIYRIISKKSLSSNEPASANIKEGMTITVGGPQSNASKPSCCTSS*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain