SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research




Warning: Undefined variable $sxsome in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $sstart in /var/www/html/include/SeqFeatClass.php on line 665

Warning: Undefined variable $send in /var/www/html/include/SeqFeatClass.php on line 665

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean/Absolute/Glyma15g43150): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1018

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1019

Warning: get_headers(): php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: get_headers(https://bar.utoronto.ca/api/efp_image/efp_soybean/soybean_severin/Absolute/Glyma15g43150): Failed to open stream: php_network_getaddresses: getaddrinfo for bar.utoronto.ca failed: Temporary failure in name resolution in /var/www/html/include/SeqFeatClass.php on line 1020

Warning: Trying to access array offset on false in /var/www/html/include/SeqFeatClass.php on line 1021

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1025

Deprecated: preg_match(): Passing null to parameter #2 ($subject) of type string is deprecated in /var/www/html/include/SeqFeatClass.php on line 1031

Report for Sequence Feature Glyma15g43150

Feature Type:gene_model
Chromosome:Gm15
Start:50685121
stop:50691131
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G08010AT Annotation by Michelle Graham. TAIR10: RNA binding | chr3:2556046-2557426 FORWARD LENGTH=374 SoyBaseE_val: 1.00E-173ISS
GO:0006364GO-bp Annotation by Michelle Graham. GO Biological Process: rRNA processing SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0009073GO-bp Annotation by Michelle Graham. GO Biological Process: aromatic amino acid family biosynthetic process SoyBaseN/AISS
GO:0009658GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast organization SoyBaseN/AISS
GO:0009704GO-bp Annotation by Michelle Graham. GO Biological Process: de-etiolation SoyBaseN/AISS
GO:0009902GO-bp Annotation by Michelle Graham. GO Biological Process: chloroplast relocation SoyBaseN/AISS
GO:0010027GO-bp Annotation by Michelle Graham. GO Biological Process: thylakoid membrane organization SoyBaseN/AISS
GO:0010155GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of proton transport SoyBaseN/AISS
GO:0010207GO-bp Annotation by Michelle Graham. GO Biological Process: photosystem II assembly SoyBaseN/AISS
GO:0016226GO-bp Annotation by Michelle Graham. GO Biological Process: iron-sulfur cluster assembly SoyBaseN/AISS
GO:0016556GO-bp Annotation by Michelle Graham. GO Biological Process: mRNA modification SoyBaseN/AISS
GO:0019761GO-bp Annotation by Michelle Graham. GO Biological Process: glucosinolate biosynthetic process SoyBaseN/AISS
GO:0034660GO-bp Annotation by Michelle Graham. GO Biological Process: ncRNA metabolic process SoyBaseN/AISS
GO:0035304GO-bp Annotation by Michelle Graham. GO Biological Process: regulation of protein dephosphorylation SoyBaseN/AISS
GO:0042793GO-bp Annotation by Michelle Graham. GO Biological Process: transcription from plastid promoter SoyBaseN/AISS
GO:0045893GO-bp Annotation by Michelle Graham. GO Biological Process: positive regulation of transcription, DNA-dependent SoyBaseN/AISS
GO:0046777GO-bp Annotation by Michelle Graham. GO Biological Process: protein autophosphorylation SoyBaseN/AISS
GO:0009507GO-cc Annotation by Michelle Graham. GO Cellular Compartment: chloroplast SoyBaseN/AISS
GO:0003723GO-mf Annotation by Michelle Graham. GO Molecular Function: RNA binding SoyBaseN/AISS
PF06485PFAM Protein of unknown function (DUF1092) JGI ISS
UniRef100_I1MJQ6UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MJQ6_SOYBN SoyBaseE_val: 0ISS
UniRef100_Q9SFB3UniRef Annotation by Michelle Graham. Most informative UniRef hit: F17A17.35 protein n=1 Tax=Arabidopsis thaliana RepID=Q9SFB3_ARATH SoyBaseE_val: 6.00E-171ISS

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology

Glyma15g43150 not represented in the dataset

Glyma15g43150 not represented in the dataset
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection
Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

ParalogEvidenceComments
Glyma10g11580 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g275900 Wm82.a2.v1IGC As supplied by JGI

Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

>Glyma15g43150.1   sequence type=CDS   gene model=Glyma15g43150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCCACTCTAAGCTTCAACCCTGTTAGAATAAAATCCCCAACGTTCAAACATTCCAAACTCACCACTCCATCAAAACGCATCACAATTCCATGCACCACTCCCTCCAACAGCCACCCCAAACTGCTCCACTTCCGACCCCGTTCGGTGTCCGAAAGCACCCAGAAAGAAGCACCCGAAGCGGTTCTCGGAGAAGAAGAAGAAGAAGAAGAAGATGATGATGATGACCCATCTGCGGAACTGAGCTACGTGGACCCAGTAACTGACCCTGAGAGCATCACGGAGTGGGAGCTGGACTTCTGCTCCAGGCCCATTCTCGACGCCAGAGGGAAGAAGGTTTGGGAGTTAGTTGTGTGCGACAAGACGCTATCGTTGCAGTACACCAAGTATTTCCCGAACAACGTCATTAACAGCATTACGCTGAAGGATGCTATTGTTGCCGTTAGTGACCAGTTGGGTGTCCCGTTGCCCAGAAACATTCGCTTCTTTAGGTCGCAGATGCAGACAATTATTACAAATGCGTGTAATGAGCTTCGCATAAGGCCTGTTCCTAGTAAACGGTGCGTGTCAATAATTCTATGGCTAGAGGAGCGCTATGAGACCGTATATAAAAAACATCCTGGATTTCAAGAAGGATCCAAACCTCTTTTGGCACTTGATAATCCTTTTCCCACGGAACTTCCTGACATTCTTTATGGGGAAAGATGGGCATTTGTCCAATTACCTTACTCAGCTGTTCGAGAGGAGATATCGACCTTTGAGAGAGGAGTTTGTGGTTCTGGGCTAGATCTTGATTTATTGGGTCTTGACATTGATGACAAGACATTGATCCCAGGACTGTCTGTTGCGTCTTCTAATTCTACAGCATTGGCAGCTTTGATAAATGGATTGGAGGTTTGCGCGGTGGAAGCGGATACTGCTCGTGCTCGCCTGATTCTTTCTAGTGGAATTTCTACTCGGTATATATATTCCACCTATAAGAAAACTCCTGAGACAACTAGTGAAGCTGAAGCTTGGGAAGCTGCTAAGAAAGCTTGTGGAGGTTTGCATTTCCTTGCAGTTCAACCAGACTTGGATTCTGAAGATTGTGTTGGCTTCTTTCTTTTACTAGACTTGCCATTTCCACCTGTATGA

>Glyma15g43150.1   sequence type=predicted peptide   gene model=Glyma15g43150   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MATLSFNPVRIKSPTFKHSKLTTPSKRITIPCTTPSNSHPKLLHFRPRSVSESTQKEAPEAVLGEEEEEEEDDDDDPSAELSYVDPVTDPESITEWELDFCSRPILDARGKKVWELVVCDKTLSLQYTKYFPNNVINSITLKDAIVAVSDQLGVPLPRNIRFFRSQMQTIITNACNELRIRPVPSKRCVSIILWLEERYETVYKKHPGFQEGSKPLLALDNPFPTELPDILYGERWAFVQLPYSAVREEISTFERGVCGSGLDLDLLGLDIDDKTLIPGLSVASSNSTALAALINGLEVCAVEADTARARLILSSGISTRYIYSTYKKTPETTSEAEAWEAAKKACGGLHFLAVQPDLDSEDCVGFFLLLDLPFPPV*







Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo