SoyBase
SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research
SoyBase
SoyBase transitions to NEW site on 10/1/2024
|
A newer version of this gene model can be found here:
| Database ID | Annotation Type | Annotation Description | Annotation Source | Match Score | Evidence Code |
|---|---|---|---|---|---|
| AT3G60830 | AT | Annotation by Michelle Graham. TAIR10: actin-related protein 7 | chr3:22474298-22476000 FORWARD LENGTH=363 | SoyBase | E_val: 0 | ISS |
| GO:0000394 | GO-bp | Annotation by Michelle Graham. GO Biological Process: RNA splicing, via endonucleolytic cleavage and ligation | SoyBase | N/A | ISS |
| GO:0006325 | GO-bp | Annotation by Michelle Graham. GO Biological Process: chromatin organization | SoyBase | N/A | ISS |
| GO:0009086 | GO-bp | Annotation by Michelle Graham. GO Biological Process: methionine biosynthetic process | SoyBase | N/A | ISS |
| GO:0009616 | GO-bp | Annotation by Michelle Graham. GO Biological Process: virus induced gene silencing | SoyBase | N/A | ISS |
| GO:0009640 | GO-bp | Annotation by Michelle Graham. GO Biological Process: photomorphogenesis | SoyBase | N/A | ISS |
| GO:0009653 | GO-bp | Annotation by Michelle Graham. GO Biological Process: anatomical structure morphogenesis | SoyBase | N/A | ISS |
| GO:0009737 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to abscisic acid stimulus | SoyBase | N/A | ISS |
| GO:0009793 | GO-bp | Annotation by Michelle Graham. GO Biological Process: embryo development ending in seed dormancy | SoyBase | N/A | ISS |
| GO:0009845 | GO-bp | Annotation by Michelle Graham. GO Biological Process: seed germination | SoyBase | N/A | ISS |
| GO:0009909 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of flower development | SoyBase | N/A | ISS |
| GO:0009933 | GO-bp | Annotation by Michelle Graham. GO Biological Process: meristem structural organization | SoyBase | N/A | ISS |
| GO:0010050 | GO-bp | Annotation by Michelle Graham. GO Biological Process: vegetative phase change | SoyBase | N/A | ISS |
| GO:0010162 | GO-bp | Annotation by Michelle Graham. GO Biological Process: seed dormancy process | SoyBase | N/A | ISS |
| GO:0010182 | GO-bp | Annotation by Michelle Graham. GO Biological Process: sugar mediated signaling pathway | SoyBase | N/A | ISS |
| GO:0010227 | GO-bp | Annotation by Michelle Graham. GO Biological Process: floral organ abscission | SoyBase | N/A | ISS |
| GO:0010228 | GO-bp | Annotation by Michelle Graham. GO Biological Process: vegetative to reproductive phase transition of meristem | SoyBase | N/A | ISS |
| GO:0010564 | GO-bp | Annotation by Michelle Graham. GO Biological Process: regulation of cell cycle process | SoyBase | N/A | ISS |
| GO:0016567 | GO-bp | Annotation by Michelle Graham. GO Biological Process: protein ubiquitination | SoyBase | N/A | ISS |
| GO:0019915 | GO-bp | Annotation by Michelle Graham. GO Biological Process: lipid storage | SoyBase | N/A | ISS |
| GO:0048366 | GO-bp | Annotation by Michelle Graham. GO Biological Process: leaf development | SoyBase | N/A | ISS |
| GO:0048825 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cotyledon development | SoyBase | N/A | ISS |
| GO:0050826 | GO-bp | Annotation by Michelle Graham. GO Biological Process: response to freezing | SoyBase | N/A | ISS |
| GO:0051301 | GO-bp | Annotation by Michelle Graham. GO Biological Process: cell division | SoyBase | N/A | ISS |
| GO:0005634 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: nucleus | SoyBase | N/A | ISS |
| GO:0005737 | GO-cc | Annotation by Michelle Graham. GO Cellular Compartment: cytoplasm | SoyBase | N/A | ISS |
| GO:0005200 | GO-mf | Annotation by Michelle Graham. GO Molecular Function: structural constituent of cytoskeleton | SoyBase | N/A | ISS |
| KOG0676 | KOG | Actin and related proteins | JGI | ISS | |
| PTHR11937 | Panther | ACTIN | JGI | ISS | |
| PTHR11937:SF26 | Panther | ACTIN | JGI | ISS | |
| PF00022 | PFAM | Actin | JGI | ISS | |
| UniRef100_B9RVQ0 | UniRef | Annotation by Michelle Graham. Most informative UniRef hit: Actin, putative n=1 Tax=Ricinus communis RepID=B9RVQ0_RICCO | SoyBase | E_val: 0 | ISS |
| UniRef100_I1MJQ3 | UniRef | Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MJQ3_SOYBN | SoyBase | E_val: 0 | ISS |
|
Glyma15g43090 not represented in the dataset |
Glyma15g43090 not represented in the dataset |
| Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection |
Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome |
| Paralog | Evidence | Comments |
|---|---|---|
| Glyma10g11530 | IGC | Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3. |
| Corresponding Name | Annotation Version | Evidence | Comments |
|---|---|---|---|
| Glyma.15g275500 | Wm82.a2.v1 | IGC | As supplied by JGI |
| Schmutz et al. 2010 Genome sequence of the palaeopolyploid soybean Nature 2010, 463:178-183 |
>Glyma15g43090.1 sequence type=CDS gene model=Glyma15g43090 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high ATGGAAGCCGCAGTGGTCGACCCGGGTTCCAGCCTCCTCAAAGCCGGTTTTGCGATTCCCGATCAAGCTCCCGCCATGATAATTCCCACCCAGATGAAACGAATGCTCGATGATGGGTCAATGACCGATAACTTGACATTCGATGACATTGCTGTCGATCCGGTGTGCCGAGGTTATGTCAGAGATTGGGATGCCTTGGAGGATTTGCTGCATTATGTATTGTATACTGGCCTTGGATGGGAAATGGGCAATGAAGGACAGATACTGTTCACGGATCCTCTTTGTACTCCAAAGGCTAACAAGGAACAGTTAGTGCAACTAATGTTTGAAACATTCAACATATCAGGGTTTTATGCCTCCGAACAAGCAGTGTTGTCACTATATGCTGTAGGACGTATCTCTGGATGCACAGTTGACATTGGTCATGGAAAAATAGATATTGCACCAGTGATTGAGGGTGCTGTTAACCACATTGCCTCAAGAAGATTTGAGTTTGGAGGTGTTGATCTAACTAATTTCCTGGCTCAAGAACTTGGCAAATCCAATCCGCTAGTGAATATCAGCATCTCTGATGTTGAGAAAATAAAACAGCAATACTCTTGCTGTGCTGAAGATGAATTAGCTTATCAGAAGACCAAAGGTTCCTGCCCTGTGGAGACACATACCCTTCCTGATGGACAGGTGATTACAATTGGACGAGAAAGATATACTGTTGGAGAAGCTTTATTCCAGCCATGTCTATTGGGTTTGGAGGCTCATGGTATTGTTGAGCAGCTTGTCCGTACTATTTCAACGGTGTCATCTGATAATCATAGGCAACTTCTTGAAAATACCGTGGTTTGTGGTGGCACTTCTTCTATGACTGGTTTTGAAGAGAGATTTCAGAAGGAATCTAGCCAAAGTTCATCTGCTATTCGACCTACCCTAGTAAAGCCTCCAGAATACATGCCAGAAAATTTAACCATGAATTCTGCATGGGTGGGAGGTGCCATACTTGCCAAAGTAGTATTTCCTCAAAATCAGCATGTAACCAAGGCAGATTATGATGAAACTGGGCCTTCCATTGTGCACCGGAAATGCTTTTGA
>Glyma15g43090.1 sequence type=predicted peptide gene model=Glyma15g43090 sequence assembly version=Glyma 1.0 annotation version=1.1 JGI Gene Call confidence=high MEAAVVDPGSSLLKAGFAIPDQAPAMIIPTQMKRMLDDGSMTDNLTFDDIAVDPVCRGYVRDWDALEDLLHYVLYTGLGWEMGNEGQILFTDPLCTPKANKEQLVQLMFETFNISGFYASEQAVLSLYAVGRISGCTVDIGHGKIDIAPVIEGAVNHIASRRFEFGGVDLTNFLAQELGKSNPLVNISISDVEKIKQQYSCCAEDELAYQKTKGSCPVETHTLPDGQVITIGRERYTVGEALFQPCLLGLEAHGIVEQLVRTISTVSSDNHRQLLENTVVCGGTSSMTGFEERFQKESSQSSSAIRPTLVKPPEYMPENLTMNSAWVGGAILAKVVFPQNQHVTKADYDETGPSIVHRKCF*
| Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA | ||
|
|
|
