SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g42740

Feature Type:gene_model
Chromosome:Gm15
Start:50166497
stop:50166982
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g42740
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT3G12630AT Annotation by Michelle Graham. TAIR10: A20/AN1-like zinc finger family protein | chr3:4012707-4013189 FORWARD LENGTH=160 SoyBaseE_val: 1.00E-58ISS
GO:0006007GO-bp Annotation by Michelle Graham. GO Biological Process: glucose catabolic process SoyBaseN/AISS
GO:0009414GO-bp Annotation by Michelle Graham. GO Biological Process: response to water deprivation SoyBaseN/AISS
GO:0016567GO-bp Annotation by Michelle Graham. GO Biological Process: protein ubiquitination SoyBaseN/AISS
GO:0051865GO-bp Annotation by Michelle Graham. GO Biological Process: protein autoubiquitination SoyBaseN/AISS
GO:0005634GO-cc Annotation by Michelle Graham. GO Cellular Compartment: nucleus SoyBaseN/AISS
GO:0003677GO-mf Annotation by Michelle Graham. GO Molecular Function: DNA binding SoyBaseN/AISS
GO:0004842GO-mf Annotation by Michelle Graham. GO Molecular Function: ubiquitin-protein ligase activity SoyBaseN/AISS
GO:0008270GO-mf Annotation by Michelle Graham. GO Molecular Function: zinc ion binding SoyBaseN/AISS
KOG3173 KOG Predicted Zn-finger protein JGI ISS
PTHR10634Panther PRK1-ASSOCIATED ZINC FINGER PROTEIN JGI ISS
PF01428PFAM AN1-like Zinc finger JGI ISS
PF01754PFAM A20-like zinc finger JGI ISS
UniRef100_E0A2W1UniRef Annotation by Michelle Graham. Most informative UniRef hit: AN1-like transcription factor n=1 Tax=Glycine max RepID=E0A2W1_SOYBN SoyBaseE_val: 2.00E-84ISS
UniRef100_UPI0001949594UniRef Annotation by Michelle Graham. Best UniRef hit: UPI0001949594 related cluster n=1 Tax=unknown RepID=UPI0001949594 SoyBaseE_val: 2.00E-113ISS

Expression Patterns of Glyma15g42740
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g42740
ParalogEvidenceComments
Glyma08g16270 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g42740 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g272300 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g42740
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g42740
>Glyma15g42740.1   sequence type=CDS   gene model=Glyma15g42740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGCTCAGAAAACCGAGAAAGAAGAAACCGACTTCAAAGTTCCGGAAACGATTACGCTTTGCGTCAACAACTGCGGCGTCACCGGAAACCCTGCCACGAATAACATGTGCCAGAAGTGCTTCACTGCCTCTACCGCCACCACTTCCGGCGCCGGAGGTGCCGGAATAGCTTCTCCGGCGACCAGATCCGGCGTCTCCGCGCGTCCTCAGAAGAGATCTTTTCCTGAAGAGCCCTCGCCGGTGGCGGATCCTCCTTCTTCGGACCAGACGACGCCGTCGGAGGCGAAGCGCGTGGTCAACCGCTGCTCCGGATGCCGGCGGAAGGTCGGACTCACCGGATTCCGGTGCCGGTGCGGCGAGCTCTTCTGCGCCGAGCACCGGTACTCCGACCGCCACGACTGCAGCTATGACTACAAAGCCGCCGGAAGAGAAGCCATCGCGAGGGAGAATCCGGTGATCAGAGCTGCGAAGATCGTCAAAGTCTGA
Predicted protein sequences of Glyma15g42740
>Glyma15g42740.1   sequence type=predicted peptide   gene model=Glyma15g42740   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MAQKTEKEETDFKVPETITLCVNNCGVTGNPATNNMCQKCFTASTATTSGAGGAGIASPATRSGVSARPQKRSFPEEPSPVADPPSSDQTTPSEAKRVVNRCSGCRRKVGLTGFRCRCGELFCAEHRYSDRHDCSYDYKAAGREAIARENPVIRAAKIVKV*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo