Glyma15g41770 - SoyBase

SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g41770

Feature Type:	gene_model
Chromosome:	Gm15
Start:	48960553
stop:	48963887
Source:	JGI
Version:	Wm82.a1.v1.1
High confidence:	yes

A newer version of this gene model can be found here:

Annotations for Glyma15g41770

Database ID	Annotation Type	Annotation Description	Annotation Source	Match Score	Evidence Code
AT1G79420	AT	Annotation by Michelle Graham. TAIR10: Protein of unknown function (DUF620) \| chr1:29871537-29874166 FORWARD LENGTH=417	SoyBase	E_val: 0	ISS
GO:0008150	GO-bp	Annotation by Michelle Graham. GO Biological Process: biological process	SoyBase	N/A	ISS
GO:0009855	GO-bp	Annotation by Michelle Graham. GO Biological Process: determination of bilateral symmetry	SoyBase	N/A	ISS
GO:0009887	GO-bp	Annotation by Michelle Graham. GO Biological Process: organ morphogenesis	SoyBase	N/A	ISS
GO:0010014	GO-bp	Annotation by Michelle Graham. GO Biological Process: meristem initiation	SoyBase	N/A	ISS
GO:0010051	GO-bp	Annotation by Michelle Graham. GO Biological Process: xylem and phloem pattern formation	SoyBase	N/A	ISS
GO:0010073	GO-bp	Annotation by Michelle Graham. GO Biological Process: meristem maintenance	SoyBase	N/A	ISS
GO:0048439	GO-bp	Annotation by Michelle Graham. GO Biological Process: flower morphogenesis	SoyBase	N/A	ISS
GO:0048519	GO-bp	Annotation by Michelle Graham. GO Biological Process: negative regulation of biological process	SoyBase	N/A	ISS
GO:0005739	GO-cc	Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion	SoyBase	N/A	ISS
GO:0003674	GO-mf	Annotation by Michelle Graham. GO Molecular Function: molecular function	SoyBase	N/A	ISS
PF04788	PFAM	Protein of unknown function (DUF620)	JGI		ISS
UniRef100_I1MJE4	UniRef	Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MJE4_SOYBN	SoyBase	E_val: 0	ISS
UniRef100_Q9SAK6	UniRef	Annotation by Michelle Graham. Most informative UniRef hit: T8K14.16 n=1 Tax=Arabidopsis thaliana RepID=Q9SAK6_ARATH	SoyBase	E_val: 4.00E-180	ISS

Expression Patterns of Glyma15g41770

Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology


Libault et al. 2010, Plant Phys 152(2):541-552. Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection	Severin et al. 2010, BMC Plant Biology 10:160 RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g41770

Paralog	Evidence	Comments
Glyma08g17390	IGC	Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g41770 Gene Call Version Wm82.a1.v1.1

Corresponding Name	Annotation Version	Evidence	Comments
Glyma.15g263800	Wm82.a2.v1	IGC	As supplied by JGI

References for Glyma15g41770

Schmutz et al. 2010
Genome sequence of the palaeopolyploid soybean
Nature 2010, 463:178-183

Coding sequences of Glyma15g41770

Limit To All Plant Sequences

>Glyma15g41770.1   sequence type=CDS   gene model=Glyma15g41770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGGGTTCTAAAGCCCGTTGGCGCCAGAGTTGGGCTCCACAGCCTTTGACACCCTTAATGGAAGGCCCTGGCCCTGAAATGCAAGAGGAAGGAACCAAGAAAGAGAGCTCTTGGGAAGTCATAAGGGAATGGTTCAGGACTCAGAAGATCTCCCCAGGTGGAAGCTTTTCACAATCATCATCATTCTATGGAACCATTCATGCCAAGACACAAGATTTGAGGTTGTTGCTTGGTGTCTTGGGTTGCCCCTTGGCTCCTATTCCCTCAGCACATGATCCCACTCTTAGTATTCACATCAAAGACACCCCATTTGAAACTTCAACTGCCAAATACATTATCCAGCAGTATTTGGCAGCCACAGGGTGCCTAAAACAACAAAAGGACACAAAGAACATGTATGCCACTGGGATGGTGAAGATGATTTGCTGTGAGACAGAGATTTCATCTGGGAAAAATGTCAAGTGTTTGGGGACAAGAAGCAGTGATAATGGTTGCTTTGTGCTTTGGCAGATGCTACCTGGTATGTGGTCTCTTGAGTTGGTGGTTGGTGACCACAAGGTGGTTGCAGGCAGCAATGGCAAGACCGTGTGGCGGCACACACCATGGCTAGGCACACATGCAGCCAAAGGCCCCCAGAGACCCCTTCGTCGCATTATTCAGGGTTTGGATCCAAAGACCACAGCGAGTTTATTCACCAACGCGCAATGCTTGGGCGAGAATCGAATCGGGACCGTCGATTGCTTCGTGCTAAAGGTCTCCGCCGATCGTGCGGCGGTGGTTGAAAGAAGTGAGGGCCCAGCAGAGGTGATAAGGCACATACTCTACGGTTACTTTTGCCAAAAGAGTGGACTCCTCATATACCTAGAAGACTCCCACCTCACAAGGGTTCCTACGCAGGACAATGATACGGTGTACTGGGAGACCACCATAGGGAGCAGCATCGGCGACTACAGGGACGTTGATGGCGTCCTCATCGCGCATCAAGGGCGGTCCATCGCGACGGTGTTCCGGTTCGGGGAGCTCTCCATGCAGCATAGCCGGACCCGGATGGAGGAGATTTGGACCATTGATGATGTTATGTTTAATGTACCTGGACTCTCCATGGACCATTTCATTCCTCCAGCTGATATCTTTGACAATATAAATTCTCCATGA

Predicted protein sequences of Glyma15g41770

Limit To All Plant Sequences

>Glyma15g41770.1   sequence type=predicted peptide   gene model=Glyma15g41770   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MGSKARWRQSWAPQPLTPLMEGPGPEMQEEGTKKESSWEVIREWFRTQKISPGGSFSQSSSFYGTIHAKTQDLRLLLGVLGCPLAPIPSAHDPTLSIHIKDTPFETSTAKYIIQQYLAATGCLKQQKDTKNMYATGMVKMICCETEISSGKNVKCLGTRSSDNGCFVLWQMLPGMWSLELVVGDHKVVAGSNGKTVWRHTPWLGTHAAKGPQRPLRRIIQGLDPKTTASLFTNAQCLGENRIGTVDCFVLKVSADRAAVVERSEGPAEVIRHILYGYFCQKSGLLIYLEDSHLTRVPTQDNDTVYWETTIGSSIGDYRDVDGVLIAHQGRSIATVFRFGELSMQHSRTRMEEIWTIDDVMFNVPGLSMDHFIPPADIFDNINSP*

Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA

U.S. Public Domain