SoyBase SoyBase transitions to NEW site on 10/1/2024
Integrating Genetics and Genomics to Advance Soybean Research

Report for Sequence Feature Glyma15g41650

Feature Type:gene_model
Chromosome:Gm15
Start:48834885
stop:48837735
Source:JGI
Version:Wm82.a1.v1.1
High confidence:yes



A newer version of this gene model can be found here:

Annotations for Glyma15g41650
Database IDAnnotation TypeAnnotation DescriptionAnnotation SourceMatch ScoreEvidence Code
AT1G70190AT Annotation by Michelle Graham. TAIR10: Ribosomal protein L7/L12, oligomerisation;Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like | chr1:26430616-26431242 FORWARD LENGTH=208 SoyBaseE_val: 1.00E-66ISS
GO:0006354GO-bp Annotation by Michelle Graham. GO Biological Process: DNA-dependent transcription, elongation SoyBaseN/AISS
GO:0006412GO-bp Annotation by Michelle Graham. GO Biological Process: translation SoyBaseN/AISS
GO:0005622GO-cc Annotation by Michelle Graham. GO Cellular Compartment: intracellular SoyBaseN/AISS
GO:0005739GO-cc Annotation by Michelle Graham. GO Cellular Compartment: mitochondrion SoyBaseN/AISS
GO:0005840GO-cc Annotation by Michelle Graham. GO Cellular Compartment: ribosome SoyBaseN/AISS
GO:0015934GO-cc Annotation by Michelle Graham. GO Cellular Compartment: large ribosomal subunit SoyBaseN/AISS
GO:0003735GO-mf Annotation by Michelle Graham. GO Molecular Function: structural constituent of ribosome SoyBaseN/AISS
KOG1715 KOG Mitochondrial/chloroplast ribosomal protein L12 JGI ISS
PTHR11809Panther RIBOSOMAL PROTEIN L7/L12 JGI ISS
PTHR11809:SF6Panther gb def: ribosomal protein [arabidopsis thaliana] JGI ISS
PF00542PFAM Ribosomal protein L7/L12 C-terminal domain JGI ISS
UniRef100_I1MJD8UniRef Annotation by Michelle Graham. Best UniRef hit: Uncharacterized protein n=1 Tax=Glycine max RepID=I1MJD8_SOYBN SoyBaseE_val: 5.00E-154ISS
UniRef100_O04527UniRef Annotation by Michelle Graham. Most informative UniRef hit: F20P5.9 protein n=1 Tax=Arabidopsis thaliana RepID=O04527_ARATH SoyBaseE_val: 7.00E-64ISS

Expression Patterns of Glyma15g41650
Gene expression representations made with eFP at the University of Toronto.
Waese et al. 2017, Plant Cell 29(8):1806-1821 ePlant: Visualizing and Exploring Multiple Levels of Data for Hypothesis Generation in Plant Biology
Libault et al. 2010, Plant Phys 152(2):541-552.
Complete Transcriptome of the Soybean Root Hair Cell, a Single-Cell Model, and Its Alteration in Response to Bradyrhizobium japonicum Infection 		Severin et al. 2010, BMC Plant Biology 10:160
RNA-Seq Atlas of Glycine max: A guide to the soybean transcriptome

To see more experiments click HERE

Paralogs of Glyma15g41650
ParalogEvidenceComments
Glyma08g17480 IGC Paralogs in soybean determined by Steven Cannon using BLAST, DAGChainer, PAML, and selection of gene pairs from synteny blocks with median Ks values of less than 0.3.

Gene model name correspondences to Glyma15g41650 Gene Call Version Wm82.a1.v1.1
Corresponding NameAnnotation VersionEvidenceComments
Glyma.15g263200 Wm82.a2.v1IGC As supplied by JGI

References for Glyma15g41650
Schmutz et al. 2010
  Genome sequence of the palaeopolyploid soybean
  Nature 2010, 463:178-183

Coding sequences of Glyma15g41650
>Glyma15g41650.1   sequence type=CDS   gene model=Glyma15g41650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
ATGAGCTTGCTTTCAAGAATAAGGCATTATTTACCCAATGGTTTATGTAGACAACCTCTTCATCCAACAGTAGTGCGGCTTAACGCTAGTAACTTAAATGTATTTTCAAGACATTTTGGTCAACCTGCGAGGAAAGAGGAGGAGGAGGAGGATGTAGAGGAAGTGGAAATTAATCAAAGAAGTCTCCCAGCTGATTTTGATCCTGCTACATTTGATCCCAATGATCATCGAGGCCCTCCATCAGAGAGAGTTTTCAGGCTTGTTGATGAGGTCGCTTCTCTTACGGTAGCTGAAGCTGCAGAATTGGGTCTCACTCTGATGAAGAAAATGGGAGTGAAGGAGATGCCTAATGTGGGATTTATGAAAGCAGGAGCTGGAAACCTGGCTGGAATGGCAGCGAAAGCACCAACAGCAGCAAAGGAGGAGCAAAAGCCAGAAAAAACTGTGTTTGAATTGAAACTCGAGTCCTACGAAGCGGCTTCCAAAATTAAAATCATCAAGGAGGTCCGGGGCTTTACTGATTTAGGTTTGAAGGAGGCAAAGGATTTAGTGGAAAAAACACCTGCTGTTATAAAGAAAGGTGTTTCAAAGGAAGAAGGGGAGCAGATAATAGAGAAATTGAAAGCTCTTGGTGCAAAAGTTGTTATGGAATGA
Predicted protein sequences of Glyma15g41650
>Glyma15g41650.1   sequence type=predicted peptide   gene model=Glyma15g41650   sequence assembly version=Glyma 1.0   annotation version=1.1   JGI Gene Call confidence=high
MSLLSRIRHYLPNGLCRQPLHPTVVRLNASNLNVFSRHFGQPARKEEEEEDVEEVEINQRSLPADFDPATFDPNDHRGPPSERVFRLVDEVASLTVAEAAELGLTLMKKMGVKEMPNVGFMKAGAGNLAGMAAKAPTAAKEEQKPEKTVFELKLESYEAASKIKIIKEVRGFTDLGLKEAKDLVEKTPAVIKKGVSKEEGEQIIEKLKALGAKVVME*






Funded by the USDA-ARS. Developed by the USDA-ARS SoyBase and Legume Clade Database group at the Iowa State University, Ames, IA
 
USDA Logo
Iowa State University Logo